Labshake search
Citations for New England Biolabs :
1401 - 1450 of 4892 citations for 6 CHLORO 2 THIOPHEN 2 YL IMIDAZO 1 2 A PYRIDINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... An adenylated adaptor was ligated to the 3’-end of the captured transcripts (Supplementary Table 3) by using a mixture of T4 RNA ligase and truncated T4 RNA ligase 2 (ThermoFisher Scientific and NEB), which served as a template for the reverse transcription primer (Supplementary Table 3) ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR product was either separated on a 2% agarose gel for 3 hours or digested overnight with MwoI (New England Biolabs) and separated on an agarose gel to determine individual fish genotypes ...
-
bioRxiv - Genomics 2020Quote: ... followed by ligation of 3’ ends with pre-adenylated DNA adapters (App-GATCGTCGGACTGTAGAACTCTGAAC/3InvdT/) using T4 RNA Ligase 2 truncated K227Q (NEB) in absence of ATP ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were generated with the primers listed in Supplementary Table 2 using HF Phusion DNA polymerase (New England Biolabs).
-
bioRxiv - Genomics 2019Quote: ... The library was prepared using the NEBNext Ultra II kit and indexes from the Dual Index Primers Set 2 (all New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The ligation mixture was then used in a PCR reaction with primers 2569/2570 (Table 2) and Phusion DNA polymerase (New England BioLabs). PCR was carried out in 50 μl reactions for 3 min at 98°C followed by 30 cycles of 1 min at 98°C ...
-
bioRxiv - Microbiology 2020Quote: High throughput sequencing libraries were prepared using RNA isolated from total RNA or PAR-CLIP samples using the NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 2; cat# E7580, New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... A 2-micron Ura3-selective plasmid was constructed from three DNA fragments using HiFi DNA Assembly Master Mix (New England Biolabs) for cloning ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Each PCR amplification product was digested overnight at 37 °C with 2 μl of CutSmart® uffer (New England Biolabs) and 0.2 μl of AccI enzyme (10 U/mL ...
-
bioRxiv - Bioengineering 2021Quote: ... was carried out (25 ng linearized vector, 10 ng purified insert, 10 µL 2 x Gibson Assembly Master Mix (New England BioLabs) and up to 20 µL H2O were mixed and incubated at 50°C for 1 hour) ...
-
bioRxiv - Cell Biology 2021Quote: ... using 35 cycles with an annealing temperature of 60 °C (see table 2 for list of primers) and cloned by Gibson Assembly Cloning Kit (EE5510S, NEB). All primers were designed using SnapGene (GSL Biotech LLC ...
-
bioRxiv - Microbiology 2020Quote: ... each reaction tube of 20 µl contained 10 µl of Q5 High-Fidelity 2× Master Mix (New England BioLabs Inc.), 20 pmol of forward and reverse primer ...
-
bioRxiv - Genetics 2022Quote: ... The resulting monophosphorylated RNAs were ligated to the 3’ adaptor (5’rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’, IDT) using T4 RNA ligase 2 in the presence of 25% PEG8000 (NEB) at 15 °C overnight ...
-
bioRxiv - Genetics 2022Quote: ... Purified sRNA was ligated to a 32 nt 3’ adaptor including unique barcodes (sRBC, Table S5, IDT) with truncated T4 RNA ligase 2 (M0373L, NEB) overnight at 16°C ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was digested with MluCI (5µl Cut smart buffer, 1.5-2 µg DNA, 3 µl MluCI (New England Biolabs Inc. (NEB), and water to make up 49 µl ...
-
bioRxiv - Microbiology 2022Quote: ... 4.5 μg of RCA material was diluted in 65 μL of nuclease-free water and treated with 2 μL of T7 endonuclease I (New England Biolabs) for 5 minutes at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins from the supernatant at 2 mg/mL were used for the Co-IP assay using Protein G magnetic beads (New England Biolabs) and a mouse monoclonal anti-HA antibody (Sigma) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR was done with 1-2 ng of plasmid and 200 nM of each primer in Phusion High-Fidelity PCR Master Mix (New England Biolabs) with pre-denaturation at 98°C for 5 sec followed by 12 cycles of 98°C for 5 sec ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 5 μl of the Phire PCR reaction was verified on a 2% agarose gel with a low molecular weight ladder (N3233S, NEB). 15 μl of PCR products were pooled and purified using PCR Purification Kit (D4013 ...
-
bioRxiv - Microbiology 2022Quote: ... Boiled tRNA was mixed with 12 μL PEG buffer mix (10 μL 50% PEG8000, 2 μL 10 × buffer B0216S; New England Biolabs). 3 μL of 5’ adenylated linkers (Table S3 ...
-
bioRxiv - Plant Biology 2022Quote: ... Libraries were size selected for cDNA target fragments of 300 bp on 2% Low Range Ultra Agarose followed by PCR amplification using Phusion DNA polymerase (NEB) for 15 cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... multiplex qPCR was performed on a Bio-Rad C1000 Touch Thermal Cycler using Hot Start Taq 2× Master Mix (NEB) with HT_Forward and HT_Reverse primers (IDT ...
-
bioRxiv - Microbiology 2022Quote: ... Presence of SARS-CoV-2 RNA was determined by using CDC primers and probes with LunaScript RT Supermix Kit (NEB) run on BioRad (Hercules ...
-
bioRxiv - Molecular Biology 2022Quote: ... The end-repaired cDNA was ligated with 2 μL barcoded adaptor (100-466-000, Pacific Biosciences) with T4 DNA Ligase (M0202, New England Biolabs) in 50 μL reaction volume at room temperature for 1 hour ...
-
bioRxiv - Molecular Biology 2022Quote: ... and a double HA tagged NanoLuc to the genomic locus was reintroduced into MluI linearized pCRIS-PITChv2 vectro backbone with NEBuilder 2× HiFi assembly (New England Biolabs)51.
-
bioRxiv - Molecular Biology 2022Quote: ... This PCR product was then introduced in MluI linearized pCRIS-PITChv2 vector via NEBuilder 2× HiFi assembly (New England Biolabs). Primers containing 20 to 22 bp homology regions corresponding to the genomic locus 5’ and 3’ of the sgRNA cleavage were used to PCR this cassette ...
-
bioRxiv - Biochemistry 2023Quote: ... Libraries were size selected for cDNA target fragments of 300 bp on 2% Low Range Ultra Agarose followed by PCR amplified using Phusion DNA polymerase (NEB) for 15 PCR cycles ...
-
bioRxiv - Biochemistry 2024Quote: Fab Fragments were generated by taking .5 mg of IgG and digesting with 2 µL of Lys C (NEB#P8109S) at 37℃ ...
-
bioRxiv - Biochemistry 2024Quote: ... After 30 mins the samples were placed on ice and 2 μl loading dye (Purple gel loading dye, no SDS, B7025 New England Biolabs) was added prior to loading 12 μl onto a 1.5% 15 x 15 cm 100 ml 0.5X TB agarose gel ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2) library for miRNAs detection utilizing NEBNext® Small RNA Library Prep Set for Illumina (New England Biolabs (UK) Ltd ...
-
bioRxiv - Cell Biology 2024Quote: ... each lysed by incubation in 1000 μL RIPA buffer + 2 mM PMSF + 60 μL PIC + 112.5 Kunitz Unit/mL DNase I (RNase-free, NEB M0303) + 2.5 mM MgCl2 (Sigma 5985-OP ...
-
bioRxiv - Systems Biology 2024Quote: ... We digested ∼2ug of each of 24 barcoded ORF plasmid pools (2 replicate pools of each of 9 hORFs and 3 vORFs) overnight with I-SceI (NEB) according to manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: ... Nicks were sealed by adding 10 μL 10x T4 DNA ligase buffer and 2 μL T4 DNA ligase (New England Biolabs) and incubating overnight at 16°C ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Microbiology 2024Quote: ... The SV40 NLS was added to the C-terminus of CypA via annealing partially complimentary primers encoding the SV40 NLS (Table S1) at 20 μM with NEB buffer 2 (New England Biolabs) at 95° C for 4 min and 70° C for 10 min ...
-
bioRxiv - Microbiology 2024Quote: ... Libraries were then size selected for cDNA target fragments of 200–300 bp on 2% Low Range Ultra Agarose followed by PCR amplified using Phusion DNA polymerase (NEB) for 15 PCR cycles ...
-
bioRxiv - Genomics 2024Quote: ... The purified scaffold insert (2 ng) was ligated with the digested intermediate plasmid library vector (200 ng) using T4 DNA Ligase (NEB) at room temperature for 45 min ...
-
bioRxiv - Microbiology 2024Quote: ... 2 kb fragments upstream and downstream of SrcF were PCR amplified with Q5 High Fidelity DNA Polymerase (New England Biolabs) and cloned in PCR amplified pEx-deletion-ermG via DNA Gibson assembly (HiFi DNA Assembly Master Mix ...
-
bioRxiv - Microbiology 2024Quote: ... Libraries were then size-selected for cDNA target fragments of 200–300 bp on 2% Low Range Ultra Agarose followed by PCR amplification using Phusion DNA polymerase (NEB) for 15 PCR cycles ...
-
bioRxiv - Microbiology 2024Quote: Quantification of SARS-CoV-2 E gene subgenomic mRNA (sgmRNA) was conducted using Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a Step One Plus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Microbiology 2024Quote: ... Four PCR fragments of around 2,700 nucleotides long were generated from cDNA using primer pairs (Suppl. Table S2) with NEB Q5 Hot-Start high-fidelity 2× Master Mix (New England Biolabs). Fragments were gel-purified with MinElute gel extraction Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ChIP-seq libraries were prepared with 2 ng of input or IP DNA using the NEBNext Ultra II DNA Library kit for Illumina (New England Biolabs). The quality of the libraries was assessed using the High Sensitivity DNA kit (Agilent ...
-
bioRxiv - Genomics 2023Quote: ... followed by digestion to ribonucleotides by incubation for 2 h at 45 °C with 0.15 U of Nuclease P1 (NEB M0660S) in 10 mM ammonium acetate pH 5 ...
-
bioRxiv - Developmental Biology 2023Quote: ... for small RNA library preparation 50 to 300 ng of total RNA was ligated with randomized 3’ adapter using T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... 50 nM of RCA primer, 1U/µL of RiboProtect (Blirt, #RT35) and 0.5 U/ µL of T4 RNA Ligase 2 (NEB, # M0239L). The ligation mix was introduced to the SecureSeal chamber and incubated on the samples for 2 hours at 37 degrees Celsius ...
-
bioRxiv - Neuroscience 2022Quote: ... 100 cells were isolated directly into low protein binding eppendorfs containing 2 ul NEBNext Single Cell Lysis Buffer (NEB, E5530S). Samples were kept on dry ice until transfer to −80 C for overnight storage.
-
bioRxiv - Microbiology 2023Quote: ... Samples were boiled for 10 min and 2 μL of 20 mg/ml proteinase K (New England Biolabs, Cat. #P8107S) were added ...
-
bioRxiv - Molecular Biology 2023Quote: ... The SNAP-tagged histones neosynthesized during the chase time were then pulse-labelled by incubating cells with 2 μM of the red-fluorescent SNAP reagent SNAP-cell TMR star (New England Biolabs) for 15 min at 37°C ...
-
bioRxiv - Genetics 2022Quote: ... 2 μg of DNA was digested with 50 units of DpnII and 5 μL NEBuffer™ DpnII (NEB, cat #R0543L), in a total volume of 50 μL ...