Labshake search
Citations for New England Biolabs :
1401 - 1450 of 4333 citations for 2H Pyrazolo 4 3 c pyridine 3 chloro 4 5 6 7 tetrahydro since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... was amplified by PCR using primers motAB-Fwd-KpnI and motAB-rev-SacI (Table S2) and ligated into plasmid pBBR1MCS-3 after restriction with enzymes SacI and KpnI (NEB). Ligation products were transformed into E ...
-
bioRxiv - Genetics 2020Quote: ... plasmid containing native 3’-UTRs were generated by excision of the 2xMyc-ADH1 3’-UTR from each RRP4/40-Myc LEU2 CEN6 plasmid by restriction digestion and cloning of the native RRP4 or RRP40 3’-UTR into each plasmid using NEBuilder HiFi Assembly (New England BioLabs).
-
Regulation of skeletal muscle metabolism and contraction performance via teneurin-latrophilin actionbioRxiv - Physiology 2021Quote: ... The LPHN-1 and -3 genes were amplified by PCR and digested by T7 endonuclease using the EnGen Mutation Detection Kit (New England Biolabs) according to directions in combination with the custom primers that flank the appropriate CRISPR-targeting regions (Fig ...
-
bioRxiv - Biochemistry 2021Quote: ... purified RNA was dissolved in 3 μl RNase H reaction mix (1x RNase H buffer [NEB], 40 pmol oligo(dT)12 ...
-
bioRxiv - Microbiology 2021Quote: ... The insert possessing the additional A at 3’ end was ligated to the linearized vector with additional deoxythymidine (T) residues using T4 DNAligase (NEB). The plf gene cluster from strain QT598 (plfQT598 ...
-
bioRxiv - Molecular Biology 2021Quote: ... An adenylated adaptor was ligated to the 3’-end of the captured transcripts (Supplementary Table 3) by using a mixture of T4 RNA ligase and truncated T4 RNA ligase 2 (ThermoFisher Scientific and NEB), which served as a template for the reverse transcription primer (Supplementary Table 3) ...
-
bioRxiv - Microbiology 2020Quote: ... A Ty tag DNA sequence was inserted at the 3’-end of the gat1 coding sequence using a Q5 site directed mutagenesis kit (NEB) and Fn and Rn primers ...
-
bioRxiv - Genetics 2021Quote: ... yoaALexAp1 5’-GCGCCCTCAT CCTGACATAA TGTCCCTTCA AATCAAGGGA CGGTAGTGTG ACGGAC-3’ and yoaALexAp2 5’-GTCCGTCACA CTACCGTCCC TTGATTTGAA GGGACATTAT GTCAGGATGA GGGCGC-3’ and amplification with the Phusion High-Fidelity DNA Polymerase PCR kit (New England BioLabs). Constructs were sequence verified.
-
bioRxiv - Genomics 2020Quote: ... followed by ligation of 3’ ends with pre-adenylated DNA adapters (App-GATCGTCGGACTGTAGAACTCTGAAC/3InvdT/) using T4 RNA Ligase 2 truncated K227Q (NEB) in absence of ATP ...
-
bioRxiv - Microbiology 2020Quote: ... DNA encoding the HALO sequence was fused to that encoding the 3’-terminus of CFF1 using Gibson Assembly (New England Biolabs) (75) ...
-
bioRxiv - Developmental Biology 2020Quote: ... which was digested with Not1 and EcoR1 to accept two overlapping PCR fragments and a 1Kb 3’Arm by Gibson assembly (NEB). Aplnr (NM 011784.3 ...
-
bioRxiv - Immunology 2021Quote: Antisense DNA probes (Table S7) were synthesized at Metabion AG and 3’ mono-biotinylated using terminal transferse (New England Biolabs) and Biotin-11-ddUTP (Jena Bioscience ...
-
bioRxiv - Genetics 2020Quote: ... and T3 (5’-AATTAACCCTCACTAAAGGG-3’) promoter-tagged PCR fragment from each gene using corresponding T7 and T3 RNA polymerase (T3:M0378S; T7:M0251S, BioLabs). Primers used for PCR are listed in Supplemental table 1 ...
-
bioRxiv - Biophysics 2020Quote: ... backbone and insert were mixed at a 1 to 3 ratio (40 fmol in total) in CutSmart® Buffer (NEB) supplemented with 3mM ATP and 10mM DTT ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 3 µL of the assembly product was used to transform 65 µL of T7 Express chemically competent cells (NEB #C2566I) according to the manufacturer’s high-efficiency transformation protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... Deletions within the nhr-23 3′ UTR reporter (cloned in pHR017) were created using a Q5 Site-Directed Mutagenesis Kit (NEB) and verified by Sanger Sequencing (Genewiz Inc.) ...
-
bioRxiv - Microbiology 2023Quote: ... an ‘A’ base was added to the 3’ end of the blunt-end phosphorylated DNA fragments using the polymerase activity of Klenow (Exo-Minus) polymerase (NEB); Illumina genomic adapters were ligated to the A-tailed DNA fragments ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-TGGCCAGACGGAATCCAATG-3’ and 5’-GTGGTGGGCCACCAAGACGG-3’, and cloned into pX330-P2A-EGFP/RFP (Zhang et al, 2017) through ligation using T4 ligase (New England Biolabs). Nup96-GFP KI U2OS cells were transfected using X-tremeGENETM 9 DNA Transfection Reagent (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... The 5’ end ligated samples were purified using PCI extraction and then the 3’ App-PE adapters were ligated to the RPF using 40 U T4 RNA ligase I (NEB). The 5’ and 3’ ligated samples were resolved on a 12% TBE-Urea polyacrylamide gel and the band corresponding to the RPF was gel-excised ...
-
bioRxiv - Cell Biology 2023Quote: ... and inserted between Gly118- and Glu119-encoding codons of odr-3 (72) in the modified pMC10 vector using NEBuilder HiFi DNA assembly (NEB). The resulting plasmid sequence was confirmed by Sanger sequencing ...
-
bioRxiv - Cell Biology 2023Quote: ... and primers listed in (Extended Data Table 3) and used for in vitro transcription by T7 RNA polymerase (New England Biolabs). Resulting RNA was purified using a spin-column kit (RNeasy mini kit ...
-
bioRxiv - Biophysics 2023Quote: ... We combined the plasmid backbone with the colony PCR insert by mixing them in molar ration 1:3 in the 2xHiFi mix (New England Biolabs). We incubated the reaction at 50°C for 60 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... and cloned under control of the hlh-3 promoter in pSL780 (Bone et al., 2016) with Gibson cloning (New England Biolabs) to generate pSL814 ...
-
bioRxiv - Biophysics 2023Quote: ... was used.23 The RNA was ligated to a 5ʹ-phosphorylated-Cy3-oligo at the 3’ end of the RNA by T4 RNA ligase (NEB) by following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 µL of RNA from 4 x 96 well plates was transferred to a 384 well plate with 3 µL of master mix containing 1 µL of a 10 mM stock of dNTPs (NEB Catalog# N0447L ...
-
bioRxiv - Immunology 2023Quote: ... were incorporated onto the mab-oligos via a 50 μl gap-fill ligation reaction consisting of 40 U Taq ligase (New England Biolabds) 3 U T4 DNA polymerase (New England Biolabs), 100 μM dNTPs ...
-
bioRxiv - Microbiology 2023Quote: ... PCRs were performed using specific reaction primer pairs specific to the appropriate parental segment (Table 3) and Q5 High-Fidelity Polymerase (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... 3 µl of the purified assembly is incubated with 50 µl of NEB 10-β-competent E.coli cells (NEB, C3019H) for 30 min at 4 ℃ ...
-
bioRxiv - Microbiology 2023Quote: ... The 32P-radioabelled RNase III.RNA complexes were washed and unique barcoded 5’ linkers and 3’ App-PE adapters were ligated to the bounded RNA using 40 U T4 RNA ligase I (NEB) for each ligation step ...
-
bioRxiv - Microbiology 2023Quote: ... was synthetized by introducing a 984 bp fragment from the 3′ end of the GEXP15 ORF into pGDB between the XhoI/AvrII (New England Biolabs). PetDuet-1 was purchased from Novagen.
-
bioRxiv - Biochemistry 2023Quote: ... The oligonucleotides were labeled at the 3’ terminus with [α-32P] dCTP (Hartmann-Analytic) by terminal transferase (New England Biolabs) prior to annealing ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 nM RNAse-free DNA fragments containing gRNA target sequences and 30 nM Cas9 or Cas12a protein (NEB, Ipswich, MA) were mixed in reaction tubes as per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... IVT RNA products (2×10-3 dilution) were tested for absence of carry-over plasmid template by PCR using Taq 2X master mix (NEB). A negative PCR result would confirm the absence of carryover plasmid in the IVT product.
-
bioRxiv - Plant Biology 2022Quote: ... The entry module pGG-B-AtU6-26-BRI1-2-C and pGG-A-AtU6-26-BRI1-3-B were generated by annealing oligos for each gRNA and ligating into BbsI-digested (New England Biolabs) Golden Gate entry vectors described in (66) ...
-
bioRxiv - Physiology 2022Quote: RNA-sequencing libraries were prepared by depleting eukaryotic ribosomal RNA with the NEBNext rRNA Depletion Kit prior to library synthesis with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina and addition of multiplex oligos using the Unique Dual Index Primer Pairs Set 3 (NEB). Library quality control was performed using Qubit and Bioanalyzer 2100 ...
-
bioRxiv - Cell Biology 2022Quote: ... The 3′ end of the fragmented RNA was dephosphorylated with T4 polynucleotide kinase (PNK, New England Biolabs, Ipswich, MA, USA) followed by heat-inactivation ...
-
bioRxiv - Molecular Biology 2024Quote: The golden gate assembly reaction was assembled in a PCR tube by mixing 100 ng of the vector with a 3 fold molar excess of the purified PCR product (calculated using the NEB bio calculator ...
-
bioRxiv - Bioengineering 2024Quote: ... Illumina adapters were ligated on at the 3′ end of the complementary strand using 1× TA Ligase Master Mix (NEB). All products were indexed and sequenced on an Illumina MiSeq instrument ...
-
bioRxiv - Plant Biology 2023Quote: ... without its Stop codon and with a Gly-Gly-Ser-Gly-linker at the 3’-end was first amplified using Q5 High-Fidelity DNA Polymerase (New England Biolabs) and the primers GGB_OEP7_F – AACAGGTCTCAAACAATGGGAAAAACTTCGGGAGC and GGC_OEP7_GGSG_R – AACAGGTCTCTAGCCTCCAGATCCTCCCAAACCCTCTTTGGATGTGG ...
-
bioRxiv - Cancer Biology 2024Quote: ... and two BsmBI Type IIS restriction enzyme sites was cloned into the 3’ end of the bovine U6 promoter using Gibson Assembly (NEBuilder HiFi, NEB) (see Supplementary Figure 1a) ...
-
bioRxiv - Systems Biology 2024Quote: ... We digested ∼2ug of each of 24 barcoded ORF plasmid pools (2 replicate pools of each of 9 hORFs and 3 vORFs) overnight with I-SceI (NEB) according to manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2024Quote: Adult worms from INF418 (nonEx106[myo-2p::GCaMP8f::unc-54 3’UTR]) and INF96 (syIs391[myo-2p::NLS::GAL4SK::VP64::unc-54 3’UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-ACG CGT ACT AGT CGA TCG CTT GTA CAG CTC GTC CAT G-3’ (reverse primer) and using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: Each 900 ng of high molecular weight NA12878 DNA was preprocessed by first blocking at the 3’ ends with Klenow (exo-) (NEB) in the presence of 10 µM dideoxynucleotides and 1X NEBuffer 3.1 for 30m at 37°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... for small RNA library preparation 50 to 300 ng of total RNA was ligated with randomized 3’ adapter using T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was diluted 1:10 and 3 µl of diluted cDNA was used as input for qPCR using Luna by NEB master mix for a 20 µL total reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... nascent RNA was isolated with streptavidin beads and barcoded adapters ligated at 3’ ends of the nascent RNA (T4 RNA ligase 1 enzyme, M0204L; NEB) overnight at 25° C ...
-
bioRxiv - Plant Biology 2023Quote: ... the RNAs were dephosphorylated and the L3 linker (Supplementary Data 1) ligated to the 3’ ends using RNA ligase (NEB). The RNA 5’ ends were radiolabeled using [γ-32P]-ATP and polynucleotide kinase and the covalently-linked protein-RNA complexes separated on a 4-12% NuPAGE Bis-Tris gel (Thermo Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... Promoters and 3’ UTRs were amplified from Col-0 genomic DNA using the primers listed in (Supp Table 3) with Q5 Hot Start High-fidelity DNA polymerase (NEB). For MBD5 and SUVH3 ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 37 °C for 1 h and ligated to a 3′ adaptor sequence using T4 RNA ligase 2 (truncated K227Q, New England Biolabs) at 22 °C for 3 h ...