Labshake search
Citations for New England Biolabs :
1351 - 1400 of 2000 citations for 6 chloro 4 hydroxyquinoline 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... the sgRNA products synthesized by VSW-3 RNAP and T7 RNAP were purified with Monarch RNA Cleanup kit (New England Biolabs) and then further purified by high performance liquid chromatography (HPLC ...
-
bioRxiv - Cell Biology 2022Quote: ... an enzyme mixture of 3 μl in volume that contains 0.01 U Bst 2.0 DNA polymerase (New England Biolabs, United States), 0.5 U SplintR ligase diluted with Diluent A (New England Biolabs ...
-
bioRxiv - Cell Biology 2022Quote: ... Total RNA (3 μg) was applied for poly(A) mRNA purification by using oligo-d(T) magnetic beads (S1419S, NEB). RNA fragmentation ...
-
bioRxiv - Genomics 2022Quote: ... The 3’ and 5’ overhangs were converted into blunt ends with NEBNext® FFPE DNA Repair Mix (NEB, Cat. M6630) and then ‘A’ base was added to 3’ blunt ends using the A-Tailing reaction (NEBNext® UltraTM II End Repair/dA-Tailing Module ...
-
bioRxiv - Genomics 2020Quote: ... 5’-AATTTCTACTAAGTGTAGAT-3’ for LbCas12a) were annealed to the bottom strand and extended by Q5 High-Fidelity DNA polymerase (NEB). IVT of the dsDNA products was performed with the HiScribe T7 Quick High Yield RNA Synthesis kit (NEB ...
-
bioRxiv - Genomics 2020Quote: ... and the 6-nt UMI at its 5’ end was then ligated to the 3’ end of the cDNAs by using Thermostable 5′ AppDNA/RNA Ligase (New England Biolabs) as described (35) ...
-
bioRxiv - Genomics 2019Quote: ... 3’ P ends of RNA were dephosphorylated by resuspending bead-nuclei in 190 µL dephosphorylation solution (1× PNK buffer (NEB), 0.1% Triton X-100 ...
-
bioRxiv - Biochemistry 2020Quote: ... Filters were then washed with 3 aliquots of 100 μL 50 mM ABC pH 8.0 before adding 1000U PNGase F (NEB #P0704) in 2M urea ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl of 10X AT buffer and 3 μl of Klenow enzyme from NEBNext® dA-Tailing Module (E6053L, NEB) was added to the sample ...
-
bioRxiv - Microbiology 2020Quote: ... 5’ – GGA GAA AAC CTT TAC TTC CAG GG-3’ and 5’ – AAT GGA TCC CAG GGG CCC-3’ using the Q5 Site-Directed Mutagenesis protocol according to the manufacturer guidelines (New England Biolabs). Michael Malim (King’s College London ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-hydroxyl standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with calf intestinal phosphatase (NEB). The cap 0 standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Vaccinia virus capping enzyme (VCE ...
-
bioRxiv - Molecular Biology 2019Quote: ... The cap 0 standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Vaccinia virus capping enzyme (VCE, NEB) in the presence of GTP and S-adenosylmethionine (SAM) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 25mer Cap 1 RNA was generated by treating the chemically synthesized 3’-FAM-labeled Cap 0 25mer RNA with mRNA Cap 2’-O-Methyltransferase (NEB) in the presence of SAM ...
-
bioRxiv - Genomics 2019Quote: ... NEBNext Universal PCR primer for Illumina (5’-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT CTT TCC CTA CAC GAC GCT CTT CCG ATC-s-T-3’) and NEBNext Index primer for Illumina (NEB, index# 9-13 for five libraries in each repeat) ...
-
bioRxiv - Molecular Biology 2019Quote: ... four point mutations were introduced in the 3′ exon of the tricRNA reporter (see Supplementary Figure S1) using Q5 Site-Directed Mutagenesis (NEB). For primer sequences ...
-
bioRxiv - Microbiology 2019Quote: ... This resulted in a SphI-end of TEF2 ORF-GFP-XhoI-NotI-TEF2 3’ flank-AatII fragment and a SphI-end of TEF2 ORF-mCherry-XhoI-NotI-TEF2 3’ flank-AatII fragment that were digested with SphI and AatII and ligated into pUC19 (NEB) to form pMBL183 and pMBL184 ...
-
bioRxiv - Genetics 2019Quote: ... with a KAPA Hyper Prep Kit (KAPA, kk8502) and then processed by 3 μl of USER™ Enzyme (NEB, M5505L) at 37°C for 15 min to open up the loop ...
-
bioRxiv - Cell Biology 2019Quote: The tcb3 gene including 500bp of the 5’ UTR and 100 bp of the 3’ UTR was amplified from purified genomic DNA using Phusion DNA polymerase (New England Biolabs). 5’Sal1 and 3’Sac1 restriction sites were introduced with amplification primers ...
-
bioRxiv - Developmental Biology 2020Quote: ... and pSP64-eGFP-F-nos1-3’UTR (Weidinger et al., 2002) constructs were linearised with SacII and NotI restriction enzymes (NEB) respectively ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and then mixed the plasmids with gBlocks in a 1:3 molar ratio in the presence of NEBbuilder HiFi DNA (New England Biolabs) assembly mix according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... reverse 5’-GTATGGAATTCCTAACGTGGCTTCTTCTGCC-3’) and cloned into pAAV-CaMKIIa-hChR2(H134R)-EYFP by restriction-ligation using BamHI/EcoRI restriction enzymes (NEB) and T4 DNA ligase (NEB) ...
-
bioRxiv - Plant Biology 2019Quote: ... The circularization of DNase treated total RNAs was performed by intramolecular ligation of 5’ and 3’ ends using 40U of T4 RNA ligase (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2019Quote: ... were bound to the beads in the presence of 1 µM DNA oligonucleotide 5’-TCTCCTCCGAAGAAA-3’ (targeting DNA) and 2 µL RNase H (5 units/µL, NEB) were added to the reaction ...
-
bioRxiv - Genomics 2019Quote: ... The ligase was killed by heating at 65°C for 10 min and then 5 µl of 10x reaction buffer 3 (NEB), 34 µl of H2O and 1 µl of PstI (NEB ...
-
bioRxiv - Genomics 2020Quote: ... NEBNext Ultra II End-prep reaction buffer (7 μl) and NEBNext Ultra II End-prep enzyme mix (3 μl, both from New England Biolabs) were added to each sample ...
-
bioRxiv - Genetics 2020Quote: ... 5’-CAA GCA GAA GAC GGC ATA CGA GAT-3’) and 20U/μl Q5 DNA Polymerase in 1X Q5 DNA polymerase reaction buffer (New England Biolabs). Reaction conditions were the same as Pre-Selection PCR ...
-
bioRxiv - Microbiology 2021Quote: The coding sequence of CTSL was tagged with a 3’V5 and cloned into CSIN using NEBuilder HiFi DNA Assembly (NEB) with primers CTSL_3’_V5_F ...
-
bioRxiv - Molecular Biology 2020Quote: ... Subcloned cells were screened for correct targeting by PCR amplification and restriction enzyme digestion (MCM10 exon 3, Hpy199III (NEB R0622); CDC45 exon 3 ...
-
bioRxiv - Biochemistry 2021Quote: ... 1000 base pairs upstream and downstream from the clpP2 gene were amplified by PCR using the A–B and C–D primer pairs from table 3 (Phusion polymerase, GC buffer, New England Biolabs). The PCR products were purified with E.Z.N.A ...
-
bioRxiv - Biochemistry 2021Quote: ... The fragments were ligated into the pLSV101 vector (1:1 and 3:1 molar ratios) with T4 DNA ligase (New England Biolabs) (10 °C for 30 s and 30 °C for 30 s alternating overnight) ...
-
bioRxiv - Biochemistry 2020Quote: ... These beads were then resuspended in equal amounts of PBS+ DNaseI digestion buffer with 3 ul (6U) of DNAseI (M0303S, NEB) and incubated at 37°C for 40min - 1h and separated by centrifuging at 2000 rpm for 2 min ...
-
bioRxiv - Neuroscience 2021Quote: ... Either the wild-type or the mutant version of the PRNP 3’U R were inserted into the digested pmirGLO vector by performing a Gibson Assembly following manufacturer`s instructions (NEB). After transformation of the cloned vectors and purification of the DNA using EndoFree Plasmid Maxi Kit (Qiagen) ...
-
bioRxiv - Biophysics 2020Quote: ... for 2 h at 37°C and IFITM3-iSNAP was stained with 3 µM SNAP-cell 647-SIR (New England Biolabs) at the same time ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... 5′-TAATCAGACAAGGAACTGATTA-3′ (Forward) and 5′-CGAAGGTGTGACTTCCATG-3′ (Reverse) were used with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in an Applied Biosystems QuantStudio 6 thermocycler or an Applied Biosystems StepOnePlus system ...
-
bioRxiv - Bioengineering 2021Quote: ... The flow cell was washed with water 3 times and then loaded with EcoRI-HF cocktail (1U EcoRI-HF (R3101, NEB) in 1X CutSmart NEB buffer ...
-
bioRxiv - Plant Biology 2021Quote: ... and 3 kb of upstream sequence containing the promoter was amplified from Arabidopsis genomic DNA using Phusion polymerase (New England Biolabs) using flanking primers and then the primers RSH1-F (TCCGTCTTGTCTGAATCAGCT ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-TAATCAGACAAGGAACTGATTA-3’ (Forward) and 5’-CGAAGGTGTGACTTCCATG-3’ (Reverse) were used with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in an Applied Biosystems QuantStudio 6 thermocycler ...
-
bioRxiv - Microbiology 2020Quote: ... The fluorescently labeled fragment was combined with the 5′ and 3′ unmodified RNAs by DNA-splinted RNA ligation using T4 DNA ligase (New England Biolabs) and purified by denaturing polyacrylamide gel electrophoresis ...
-
bioRxiv - Plant Biology 2021Quote: ... and the 3’ UTR sequence (310 bp downstream of the stop codon) were amplified by PCR using Phusion DNA polymerase (NEB) from genomic Col-0 DNA with IRT1p_-1024F 5’- CACCGACACATTAAACATTCATACCCGATT-3’ and IRT1_1546R 5’- CTTTAATTTACTTATCTTGAAAAAGCAGC-3’ ...
-
bioRxiv - Microbiology 2020Quote: ... The RNA fragments were ligated with 3’-barcoded adaptors at 22 °C for 1 h and 30 min using T4 RNA Ligase (NEB). Barcoded RNA samples were pooled together ...
-
bioRxiv - Microbiology 2020Quote: ... designed to bind upstream of the polyA- tail at the 3’ end of the genome and dNTPs (10 mM, NEB), and incubated at 65 °C for 5 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNAs were isolated from Calu-3 infected cells 48h post infection using the Luna Cell Ready Lysis Module (New England Biolabs). Viral RNA were quantified by qRT-PCR in triplicate as described in [27] ...
-
bioRxiv - Microbiology 2021Quote: ... and reverse primer harboring ApaI site (5’- TATAGGGCCCTGCAATTTTTGGCTATG-3’) of the corresponding DNA sequence from pNL43 into the linearized pMiniT 2.0 vector (NEB, USA) as per manufacturer-recommended protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pmex-5::PH-GFP-cyk-1(700-1437)::tbb-2 3’UTR in the pCFJ150 backbone [89] was made using HiFi cloning (New England Biolabs). Notably ...
-
bioRxiv - Biochemistry 2021Quote: ... The reaction was stopped with the addition of 0.2% SDS and 3 units of Proteinase K (New England Biolabs, #P8107S), and incubated for 1 hr at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... and then ligated to pre-annealed double-stranded adaptors that contain single dT overhangs and a unique molecular identifier (UMI) consisting of a randomized 8-base sequence containing a 3-base specific barcode by T4 DNA ligase (NEB) overnight at 15 °C ...
-
bioRxiv - Microbiology 2020Quote: ... Linkers (5’-ACTAGTTCCGAGCTCGAG-3’) with restriction sites for SpeI and XhoI were introduced by PCR based mutagenesis using the Q5 mutagensis kit (NEB) after codon 466 of nsP2 (2EGFP ...
-
bioRxiv - Microbiology 2020Quote: ... 3-5 μg of RNAse H treated RNA was circularized using T4 RNA ligase 1 (ssRNA Ligase, New England Biolabs), RNA was extracted with phenol/chloroform approach and ethanol precipitated ...
-
bioRxiv - Genomics 2021Quote: ... a lentiCRISPRv2 derivative containing an optimized scaffold (5’-GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTT-3’)40 were digested sequentially with NheI and BamHI (New England Biolabs). The vector and fragment were purified using the QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... 50 ng of vector and 150 ng of each fragment were mixed with 3 μl of HiFi DNA Master Mix (NEB) and incubated at 50°C for 1 hour to form the new pCDH-TagBFP-T2A-myc-BirA*-Tensin3 construct ...