Labshake search
Citations for New England Biolabs :
1301 - 1350 of 2459 citations for 6 CHLORO 3 METHYLPYRIDO 3 4 D PYRIMIDIN 4 3H ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... at 37 °C for 1 h and ligated to a 3′ adaptor sequence using T4 RNA ligase 2 (truncated K227Q, New England Biolabs) at 22 °C for 3 h ...
-
bioRxiv - Genetics 2023Quote: ... and SWI4 3’UTR (1000 bases downstream of ORF) were cloned into a LEU2 single integration vector by Gibson assembly (NEB) (Gibson et al. ...
-
bioRxiv - Biochemistry 2024Quote: ... reverse 5’-GTGGCC CTCGAG TCA GTG AGT TTC ATG TTG G-3’ and then purified using the Monarch PCR plus DNA purification kit (NEB). The purified PCR product was digested by KpnI and XhoI (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... Double stranded on-bead DNA was digested with a mix of 3 blunt cutting enzymes (SspI-HF, StuI, and HincII) (NEB) to generate blunt-end DNA ...
-
bioRxiv - Microbiology 2023Quote: Lysates of U2OS cells infected with wild-type HSV-2 186 at an MOI of 3 for 24 h were treated with calf intestinal alkaline phosphatase (CIP) (New England BioLabs) as described previously60.
-
bioRxiv - Molecular Biology 2023Quote: ... 5′ phosphorylated and 3’ A-tailed by NEBNext Ultra II End Prep Enzyme Mix following the manufacturer’s instruction (New England Biolabs #E7645L). An adaptor was ligated ...
-
bioRxiv - Genomics 2023Quote: ... The DNA with end tags was oxidized in 15 μL TET2 reaction mix (3 μL TET2 reaction buffer plus reconstituted TET2 reaction buffer supplement (NEB), 0.3 μL oxidation supplement (NEB) ...
-
bioRxiv - Bioengineering 2023Quote: ... The error-prone PCR (with an error rate of 3- to 5-nucleotide mutations per kilobase) was carried out with the Taq DNA polymerase (New England BioLabs) in a reaction containing 2 µl of 10 mM primers ...
-
bioRxiv - Microbiology 2023Quote: ... A second DNA adapter (containing a random-mer of 10 (N10) random bases at the 5′ end) was then ligated to the cDNA fragment 3′ end (T4 RNA Ligase, NEB) in the presence of a high concentration of PEG8000 and dimethyl sulfoxide (DMSO) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNAs were ligated to 3′ adapters ( rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight ...
-
bioRxiv - Microbiology 2024Quote: The msdDNA cDNA was isolated from acrylamide gels and 100 ng was used to extend the 3’ end with dCTP or dGTP and terminal deoxynucleotidyl transferase (TdT) from NEB, according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with 15 µl of anti-MBP couped beads (pre-blocked for 1h in RIPA with 3 % BSA; NEB) for 2 h ...
-
bioRxiv - Developmental Biology 2024Quote: ... along with 5 ng/μl Pmyo-3::GFP and 20 ng/μl of 2-Log DNA ladder (New England BioLabs), to generate the DLS344 strain ...
-
bioRxiv - Cell Biology 2024Quote: ... The inserts and the backbone were mixed in a 3:1 ratio and incubated with the 2x NEBuilder HiFi DNA assembly enzyme mix (New England Biolabs) for 1h at 50°C ...
-
bioRxiv - Cell Biology 2024Quote: ... the newly produced CENP-A-SNAP pool was labelled by exposing the mitotic cells to media containing 3 µM SNAP-Cell 647 (NEB) and 5 µM STLC (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using a 5′ DNA adenylation kit at the 5′ end (NEB). To reduce ligation bias ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the radiolabeled 3’ fragment was ligated to an unlabeled 5’ fragment by splinted ligation with T4 DNA ligase (NEB) at 30°C for 2 h ...
-
bioRxiv - Genomics 2024Quote: ... The backbones for the Gibson reaction for GRB2-SH3 and PSD95-PDZ3 library assembly (aPCA plasmids) were first linearized using primers listed in Extended Data Table 3 and next treated with Dpn1 (NEB) restriction enzyme to remove the circular plasmid template ...
-
bioRxiv - Cell Biology 2024Quote: ... we microinjected 5 ng/μl Pmyo-3::GFP and 95 ng/μl of 2-Log DNA ladder (New England BioLabs) into the germline of GRD-3::mKate2 animals to generate transgenics expressing a muscle-specific GFP marker.
-
bioRxiv - Molecular Biology 2024Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then ligated to the 3’ end of the cDNA by using Thermostable 5’ App DNA/RNA Ligase (New England Biolabs) for 2 h at 65°C ...
-
bioRxiv - Biophysics 2024Quote: ... A 30 nt 3′ overhang was created by treating the purified PCR product with USER enzyme mix (NEB, Cat# M5505S) for 15 min at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... The oligonucleotide-based DNA substrate used for the helicase and nuclease assays was generated by labeling the BIO100C oligonucleotide (see Table S1 for oligonucleotides sequence) at the 3’ end using terminal transferase (New England Biolabs) and [α-32P]dCTP (Hartmann Analytic ...
-
bioRxiv - Molecular Biology 2024Quote: ... A second adapter was then ligated to the 3’OH of the cDNAs (with NEB HC RNA Ligase in NEB ligation buffer plus 5% DMSO ...
-
bioRxiv - Immunology 2024Quote: ... A custom ribonucleoside blend was used comprising 3′-O-Me-m7G(5′)ppp(5′)G cap analog (New England Biolabs), ATP ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and then adenylated at the 5′ end with a 5′ DNA adenylation kit (NEB). Four random nucleotides were added in the 3′ and 5′ adapters [(5′ -rAppNNNNTGGAATTCTCGGGTGCCAAGG/amino CA linker-3′ ...
-
bioRxiv - Biochemistry 2024Quote: ... cDNA was PCR amplified using the primers directed against 5′ and 3′ RNA cassettes and NEB Q5 HotStart polymerase (NEB). To introduce unique barcodes ...
-
bioRxiv - Synthetic Biology 2024Quote: ... signal was synthesized by Integrated DNA Technologies and inserted at the 3’UTR of the L1 mRNA using Hifi Assembly mix (NEB). gBlocks gene fragments containing different PBS site sequences were synthesized by Integrated DNA Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: Libraries of immunoprecipitated DNA were generated from 3 ng of starting DNA with the NEBNext Ultra DNA Library Prep kit for Illumina (New England Biolabs) according to manufacturer’s instructions at the CRG Genomics Core Facility (Barcelona ...
-
bioRxiv - Molecular Biology 2024Quote: ... primer O3P (Supplementary Table 3) was attached to IP-purified DNA and was extended by NEBNext Ultra II Q5 Master Mix (New England Biolabs), followed by ExoI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified extension products were denatured and ligated to adaptor 2 (Ad2, Supplementary Table 3) by Instant Sticky-end Ligase Master Mix (New England Biolabs) at 4 °C overnight ...
-
bioRxiv - Immunology 2024Quote: ... the wild type and mutant pBlueScript SK(+) HEV plasmids were linearized at their 3′ end with the MluI restriction enzyme (NEB) and transcribed with the mMESSAGE mMACHINE T7 Transcription kit (Ambion #1344) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The variant library was ligated into each vector with a 1:3 (insert: vector) T4 ligation at 16°C overnight (NEB). Ligations were DNA cleaned (Zymo) ...
-
bioRxiv - Microbiology 2019Quote: ... overnight at 4°C followed by Alexa Fluor 488 goat anti-rabbit secondary antibody (New England Biolabs, UK) for 1h ...
-
bioRxiv - Molecular Biology 2019Quote: ... centrifuged 10min at 4000g and incubated with oligo(dT)25 beads 30min at 4°C (New England Biolabs). Remaining steps for polyA RNA isolation were performed as described [18] ...
-
bioRxiv - Genomics 2020Quote: ... CpG dinucleotides were methylated by incubating 1µg of DNA with S-Adenosyl methionine (SAM) (32µM) with CpG Methyltransferase (M.SssI) (4-25 units) (New England BioLabs) at 37°C for 1h before heating to 65°C for 20mins.
-
bioRxiv - Genomics 2020Quote: ... by incubating 1µg of DNA with S-Adenosyl methionine (SAM) (32µM) with CpG Methyltransferase (M.SssI) (4-25 units) (New England BioLabs) at 37°C for 1h before heating to 65°C for 20mins.
-
bioRxiv - Cell Biology 2020Quote: ... The extract was incubated for 1 h at 4 °C with amylose resin (New England Biolabs, Ipswich, MA), loaded onto a column ...
-
bioRxiv - Systems Biology 2020Quote: Single hematopoietic stem and progenitor cells were index-sorted into 384 well plates containing 0.5 µl of nuclease free water with 0.2% Triton-X 100 and 4 U murine RNase Inhibitor (NEB), spun down and frozen at −80°C ...
-
bioRxiv - Systems Biology 2021Quote: ... Then a plasmid library was assembled using 4 independent reactions of NEBuilder HiFi DNA Assembly (New England Biolabs) to avoid biases in assembly that might affect the library’s distribution ...
-
bioRxiv - Biochemistry 2022Quote: ... The unbound fraction was then incubated for 1 hour at 4 °C with lambda phosphatase (New England Biolabs), calf intestinal phosphatase (New England Biolabs) ...
-
bioRxiv - Cell Biology 2022Quote: ... pEXKm5 was digested with HindIII and the 4 fragments were assembled via Gibson cloning (New England Biolabs, E2611S).
-
bioRxiv - Microbiology 2022Quote: ... DNA was synthesized from extracted RNA using 4 μL LunaScript RT SuperMix 5X (New England Biolabs, NEB, USA) and 8 μL nuclease free water ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was synthesized from extracted RNA using 4 μL LunaScript RT SuperMix 5X (New England Biolabs, NEB, USA) and 8 μL nuclease free water ...
-
bioRxiv - Neuroscience 2021Quote: ... nuclei were resuspended in 200uL digestion buffer with 4 uL protease (an equal volume of protease K (NEB) was substituted if the manufacturer-provided protease was exhausted ...
-
bioRxiv - Genomics 2019Quote: ... (iii) Polymerase for Ad2 amplification: Libraries #1 and #4 were amplified using Q5 high-fidelity DNA polymerase (NEB). Library #2 was amplified using Pfu Turbo Cx ...
-
bioRxiv - Molecular Biology 2020Quote: ... the single cell tagmentation product was mixed well with 4 units of Bst 3.0 DNA Polymerase (NEB, Cat.No.M0374) and indexed common primers (Vazyme ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 million permeabilized cells (without any antibodies bound) were incubated with 4 units of Dam enzyme (NEB, M0222L) during the activation step ...
-
bioRxiv - Genomics 2021Quote: ... We then performed a kinase treatment adding 4 μl of T4 Polynucleotide Kinase (PNK, New England BioLabs Inc.), 5 μl of 10X PNK buffer ...
-
bioRxiv - Plant Biology 2019Quote: ... Purified DNA fragments were ligated overnight at 4°C with T4 DNA ligase (New England Biolabs, Ipswich MA) per manufacturer’s recommendations ...