Labshake search
Citations for New England Biolabs :
1301 - 1350 of 1925 citations for 6 Bromo 2 naphthyl sulfate potassium salt since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µl 10 x dNTPs with dUTP instead of dTTP (2 mM each) and 1 µl T4 polymerase (NEB) were added and the mixture was incubated at 37°C in a thermal cycler for 20 min ...
-
bioRxiv - Biophysics 2022Quote: ... both were mixed (∼5μM acceptor strand and ∼2 μM phosphorylated donor strand in a final volume of 19μl) in T4 RNA ligation buffer (New England BioLabs) supplemented with 1mM ATP (New England BioLabs) ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... and permeabilized for 5 min on ice in PBS containing 0.5%Triton X-100 and 2 mM Ribonucleoside Vanadyl complex (New England Biolabs). Coverslips were preserved in 70% EtOH at -20°C ...
-
bioRxiv - Genomics 2019Quote: ... and resuspended in 198 µL A-tailing solution (1× NEB buffer 2, 500 mM dATP, 1% Triton X-100). DNA ends were A-tailed by adding 1.5 µL Klenow (exo- ...
-
bioRxiv - Developmental Biology 2020Quote: ... oligonucleotides for the HAS-1 or HAS-2 sgRNA guide sequences were phosphorylated using T4 PNK (NEB, Ipswich, MA) for 30 min at 37°C ...
-
bioRxiv - Immunology 2019Quote: ... Single cells were flow-sorted into 96-well plates containing 2 µL of nuclease-free water with 0.2% Triton X-100 and 4 U murine RNase inhibitor (NEB), centrifuged ...
-
bioRxiv - Developmental Biology 2019Quote: Pceh-23_L::acy-2 fragment (sense/anti-sense) Pceh-23_L::acy-2 fragment(sense) was generated with a Gibson assembly cloning kit (NEB) by assembly of the following two DNA fragments ...
-
bioRxiv - Molecular Biology 2019Quote: ... SI) were incubated for 2 hours at RT in T4 ligase buffer with 400 U of T4 ligase (NEB) in a total volume of 100 µl ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and 1.5 mg of protein was cleaved in a 2 ml reaction with 240 Units of TEV protease (NEB) for two hours at 30 °C ...
-
bioRxiv - Genetics 2021Quote: ... 53.5 μl of cut 3C library was mixed with 6.5 μl NEBNext FFPE Repair Buffer and 2 μl NEBNext FFPE Repair Mix (New England Biolabs), followed by incubation at 20°C for 15 minutes and addition of 3 volumes of AMPure XP beads for purification.
-
bioRxiv - Plant Biology 2020Quote: ... A 3 μl aliquot of the purified DNA fragments was blunted in a 20 μl reaction containing 2 μl buffer 2.1 (New England Biolabs), 1 μl 2 mM dNTPs ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 5 µl of CutSmart buffer and 2 µl of EcoRI-HF® (New England Biolabs, catalog no. R3101) were added before incubation for 6 h at 37°C ...
-
bioRxiv - Bioengineering 2021Quote: ... and assembled with oncocin and true negative oligo inserts (Supplementary Table 2) with NEBuilder® HiFi DNA Assembly (NEB), and cloned in 5α E ...
-
bioRxiv - Bioengineering 2021Quote: The LAMP reagent mix in a total volume of 25 μL contained 12.5 μL of WarmStart or Colorimetric WarmStart 2 × Master Mix (New England BioLabs) or Bsm polymerase (Thermo Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... non integrated plasmids were cut by 2 h digestion at 37 °C with I-CeuI restriction enzyme (NEB, R0699S) in a total volume of 70 ul followed by 20 minutes heat inactivation at 65 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... The Pre-hybridization Buffer was replaced with 250 μl of Hybridization Buffer (2x SSC, 10% deionized formamide, 0.1% Tween-20, 2 mM vanadyl ribonucleoside complex (New England Biolabs), 100 μg/mL salmon sperm DNA (Invitrogen) ...
-
bioRxiv - Physiology 2021Quote: ... with 2 mL freshly prepared TST buffer (0.03% Tween 20 [Bio-Rad], 0.01% Molecular Grade BSA [New England Biolabs] ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 2 μl of the circularized product was then used for PCR amplification using Phusion High-Fidelity DNA Polymerase (NEB) for a maximum of 16 cycles ...
-
bioRxiv - Bioengineering 2021Quote: 2 μl of genomic DNA was used to amplify strain barcodes by PCR (Q5 NEB master mix, 22 cycles) using primers containing sequence-optimized spacers to maximize nucleotide diversity in Illumina sequencing ...
-
bioRxiv - Systems Biology 2020Quote: ... We discarded the supernatant and resuspended the pellet in 2 mL of 1x NEB buffer 3.1 (New England Biolabs).
-
bioRxiv - Microbiology 2021Quote: ... 40 μL purified supernatant were combined with 2,500 units recombinant glycerol-free PNGase F and Glycobuffer 2 (New England Biolabs) following the manufacturer’s protocol for non-denaturing digestion and incubated at 37°C for 5 hours ...
-
bioRxiv - Biophysics 2020Quote: ... and loaded denatured (70 °C, 10 minutes) samples alongside an RNA ladder (2-4 μL, ssRNA ladder, N0362S, NEB). The resulting gels were stained with ethidium bromide for 30 minutes (0.5 μg/mL ddH20 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The pellet was dissolved and digested in 50 ml buffer A with 2 mM CaCl2 and 4,000 units of micrococcal nuclease (M0247S, NEB) at RT for 20 min ...
-
bioRxiv - Bioengineering 2022Quote: ... 2 ul of cDNA without dilution was used for each PCR reaction by Phusion® HighFidelity DNA Polymerase (NEB) for 35 cycles ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 μg of supercoiled plasmid DNA was incubated at 37 °C for 3 hours with purified SpRY protein at a final concentration of 1 μM and IVT gRNA (prepared without DNase treatment) at a final concentration of 2 μM in Buffer 3.1 (NEB). Reactions were stopped by the addition of 1 μL of Proteinase K (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... for 2 hours at 37°C and purified using Monarch® DNA Gel Extraction Kit (T1020S, New England Biolabs) before digestion-ligation with the gRNA-pScaffold-H1 using FastDigest Esp3I and T7 Ligase (M0318L ...
-
bioRxiv - Genomics 2019Quote: ... We added 1 μL 12.5% Triton-X to each well to quench the SDS and 12.5 μL NEBNext High-Fidelity 2× PCR Master Mix (NEB). Samples were PCR-amplified for 12 cycles (72 °C 5 min ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The solution was then equilibrated to 42°C for 10 min before adding 2 μL of β-agarase (NEB). Finally ...
-
bioRxiv - Biochemistry 2021Quote: ... The reactions were stopped by addition of 2 μl of no SDS-purple gel loading dye (New England BioLabs) or 50% glycerol ...
-
bioRxiv - Genetics 2020Quote: 300 intestinal stem and Paneth cells were sorted into 2 μl of nuclease free water with 0.2% Triton-X 100 and 4 U murine RNase Inhibitor (NEB). RNA was reverse transcribed (Invitrogen ...
-
bioRxiv - Synthetic Biology 2021Quote: ... USA). DNA amplification from a single colony (i.e. colony PCR) was performed with One Taq 2× Master Mix (NEB). Electrocompetent P ...
-
bioRxiv - Genomics 2021Quote: ... and permeabilized for 5 min on ice in PBS containing 0.5% Triton X-100 and 2 mM Ribonucleoside Vanadyl complex (New England Biolabs). Coverslips were preserved in 70% EtOH at −20 °C ...
-
bioRxiv - Synthetic Biology 2021Quote: ... up to 2 μg of plasmid DNA was incubated for 4 h at 37°C with 2 μl of CpG Methyltransferase from M.SssI (NEB) in 1× Methyltransferase Reaction Buffer supplemented with 2 μl of diluted SAM (6.4 mM) ...
-
bioRxiv - Microbiology 2021Quote: ... DNA oligonucleotides (Supplementary Table 2) were radiolabeled at the 5’ end by T4 Polynucleotide kinase (PNK) (New England Biolabs) treatment and [γ-32P] (PerkinElmer ...
-
bioRxiv - Genomics 2019Quote: ... We added 1 µL 12.5% Triton-X to each well to quench the SDS and 12.5 µL NEBNext High-Fidelity 2× PCR Master Mix (NEB). Samples were PCR-amplified (72 °C 5 min ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: INS-1 832/3-SNAP-GLP-1R cells on Thermanox coverslips (Agar Scientific) were labeled with 2 μM SNAP-Surface-biotin (a gift from Dr Ivan Corrêa Jr, New England Biolabs), and 5 μg/ml NaN3-free Alexa Fluor 488 Streptavidin ...
-
bioRxiv - Genetics 2021Quote: ... Cells were fixed in 3% paraformaldehyde in PBS for 10 min at room temperature and permeabilized for 5 min on ice in PBS containing 0.5%Triton X-100 and 2 mM Vanadyl-ribonucleoside complex (New England Biolabs). Coverslips were stored in −20°C in 70% EtOH until further use.
-
bioRxiv - Genetics 2021Quote: ... We added 1 µL 12.5% Triton-X to each well to quench the SDS and 12.5 µL NEBNext High-Fidelity 2× PCR Master Mix (NEB). Samples were PCR-amplified (72 °C 5 min ...
-
Nonsense Mediated RNA Decay Is a Unique Vulnerability of Cancer Cells with SF3B1 and U2AF1 MutationsbioRxiv - Cell Biology 2021Quote: ... Genomic DNA (2 μg) was then treated with buffer alone or with 1 unit RNase H enzyme (NEB, MO297S) for 2 hours at 37 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... Heparinase digests were performed for 2 hours at 37 °C with a mixture of Heparinase I + II and III (3.5 mUnits/ml, NEB) in Heparinase digestion buffer (20 mM Tris ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... proteins (2 mg mL-1) were incubated with 180000 U mL-1 PNGase F (New England Biolabs, Unites States) in PBS (pH 7.4 ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA libraries for Illumina sequencing were prepared with the NEBNext Ultra 2 DNA Library Kit for Illumina (NEB, E7645L) using 200ng of DNA and custom made unique dual indices (8bp) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplicons were A-tailed by incubating 750 ng of DNA with 2 Units of Taq DNA Polymerase (NEB) and 0.2 mM dATP (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... without codon optimization and was inserted into pcDNA 3.1 to g et pcDNA 3.1-SARS-CoV-2-Spike using NEBuilder® HiFi DNA Assembly Master Mix (NEB) a ccording to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: The furin cleavage specificity was assayed by incubating 2.5 μg (7.6 μM) S1/S2-GB1-6xHis substrate with 2 U furin (New England Biolabs, p8077) in 30 μl reactions ...
-
bioRxiv - Biochemistry 2022Quote: ... were assembled using 10 μl of 2× master mix at 50 °C for 1 h according to manufacturer’s instructions (NEB). 5α Competent Escherichia coli (30 μl ...
-
bioRxiv - Genetics 2022Quote: ... 1 µL of extracted genomic DNAs and 5 µL of 2× Hot Start High Fidelity Q5 Master Mix (NEB). PCR reactions were carried out under the following condition ...
-
bioRxiv - Genetics 2022Quote: ... Embryos were fixed in 3% paraformaldehyde in PBS for 10 min at room temperature and permeabilized for 4 min on ice in PBS containing 0.5% Triton X-100 and 2 mM Vanadyl-ribonucleoside complex (New England Biolabs). Coverslips were stored in 70% EtOH in −20°C no longer than 1 day before further processing.
-
bioRxiv - Molecular Biology 2023Quote: ... The AAV transfer vectors used for 3-plex sgRNA delivery into skeletal muscle were cloned between AAV serotype 2 ITR’s including a cloning site for multiplexed hU6-sgRNA insertions (MluI and KpnI (NEB)) ...