Labshake search
Citations for New England Biolabs :
1301 - 1350 of 3752 citations for 5 Bromobenzothiazole 2 sulfonic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2024Quote: ... Cas12a RNP: (13 µl water; 2 µl r2.1 buffer [NEB, Cat ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 2 units of Phusion High-Fidelity DNA Polymerase (NEB) in HF Phusion buffer ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 μL of T4 DNA Polymerase (3 U/μL, NEB) 1 μL of Klenow DNA Polymerase (5 U/μL ...
-
bioRxiv - Systems Biology 2024Quote: ... and 1 μL of Phusion Polymerase (2 U/μL, NEB) were added and mixed by pipette ...
-
bioRxiv - Systems Biology 2024Quote: ... and 2 μL of DNA Polymerase I (10U/μL, NEB) were added and mixed by pipetting ...
-
bioRxiv - Systems Biology 2024Quote: ... and 2 μL of T4 PNK (10 U/μL, NEB) were added ...
-
High-resolution profiling reveals coupled transcriptional and translational regulation of transgenesbioRxiv - Synthetic Biology 2024Quote: ... treated with 2 µL DNase I (New England Biolabs, M0303), and incubated at 37°C for 30 min to degrade the IVT PCR template DNA ...
-
bioRxiv - Microbiology 2024Quote: ... burgdorferi cells using QuickLoad 2× Taq Master Mix (NEB, M0271). Positive clones were flash frozen on dry ice in BSK-II containing 10% DMSO (Sigma ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 2 µL of 20 µM SpCas9 (New England Biolabs M0646T) were gently mixed with 2 µL of 100 µM gRNA ...
-
bioRxiv - Genomics 2024Quote: ... was added to the gDNA in 1x NEBuffer 2 (NEB) in a final volume of 25 µL and incubated for 30-min at 37°C ...
-
bioRxiv - Genetics 2024Quote: ... 2 μL of T4 Ligase buffer (New England Biolabs, USA) and 1 μL of T4 Polynucleotide Kinase (10 U/μL ...
-
bioRxiv - Biophysics 2024Quote: ... before annealing and ligated using T4 RNA ligase 2 (NEB). Constructs containing 30 nt gaps ...
-
bioRxiv - Genomics 2024Quote: ... and 50 μL of NEBNext 2× Master Mix (NEB M0541S). oGH840.1-6 are six oligonucleotides with variable lengths to stagger and phase the sequencing of a common sequence in the target site amplicon ...
-
bioRxiv - Genetics 2024Quote: ... and digested with 2 μl of β-agarase I (NEB) at 42 °C for 90 min ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 units of either DNase I or T7 Exonuclease (NEB) were then added ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 μL of T4 DNA ligase (NEB, 400000 U/mL), and 4 μL of 10X T4 DNA ligase buffer (NEB) ...
-
bioRxiv - Genetics 2024Quote: ... using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541S). We inserted these three fragments into the pLS-SceI plasmid (Addgene ...
-
bioRxiv - Developmental Biology 2024Quote: ... together with 2 µM of Cas9 protein (NEB, Cat# M0646T). Tol2-plasmids were diluted in 0.05% Phenol red to a final concentration of 100 ng/µL ...
-
bioRxiv - Microbiology 2021Quote: ... The first EcoRI restriction site at 829 bp within the AgeI and KasI restriction sites in RGD4C-AAVP-TNF was deleted in two steps to mutate a thymidine to cytosine nucleotide at position 833 without altering the translated amino acid using the Q5 site-directed mutagenesis kit (New England Biolabs, Ipswich, MA) by following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: The viral nucleic acids detected by PCR of the LTR-gag region were digested with the restriction endonuclease ScaI (New England BioLabs, Beverly, MA), which cuts within the amplicon of HIV-2287 but not SIVmne ...
-
bioRxiv - Biochemistry 2023Quote: Amino acid sequencing and glycan localization were carried out by digesting the antibody samples with trypsin or chymotrypsin (New England Biolabs, Ipswich, MA) followed by LC-MS/MS analysis of proteolytic fragments with an Orbitrap Fusion (Thermo ...
-
bioRxiv - Biochemistry 2024Quote: ... N-glycanase treatment was performed by dissolving the samples in 50 mM Tris-HCl (pH 8.0) and 10 nM ethylenediaminetetraacetic acid (EDTA) containing 3 units/μL PNGaseF (New England BioLabs, Inc. MA, USA) and incubated for 4 h at RT ...
-
bioRxiv - Cancer Biology 2024Quote: ... was purchased from GeneCopia (EX-OL00093-LX304).The C-terminal 11 amino acids were deleted using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, E0554S). Primers were designed using the NEBase Changer tool to generate the deletion were ...
-
An mRNA processing pathway suppresses metastasis by governing translational control from the nucleusbioRxiv - Cancer Biology 2021Quote: ... Unligated linkers were removed from the reaction by yeast 5’-deadenylase (NEB) and RecJ nuclease (NEB ...
-
bioRxiv - Genomics 2020Quote: ... DNA ends were dephosphorylated by addition of 5 μL rSAP (NEB, M0203) and incubation at 37°C for 45 min ...
-
bioRxiv - Microbiology 2020Quote: ... These DNA fragments were subsequently 5’ phosphorylated using T4 PNK enzyme (NEB), then cloned into a SmaI-cut pUC19 using T4 DNA ligase (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAs were monophosphorylated on their 5’ ends using T4 polynucleotide kinase (NEB) and either 3 mM unlabeled ATP (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... Obtained RNAs were 5’-radiolabelled with T4 polynucleotide kinase (New England Biolabs) and [γ32P] adenosine triphosphate (ATP ...
-
bioRxiv - Molecular Biology 2020Quote: This oligonucleotide was adenylated using the 5’ DNA adenylation kit (NEB, E2610S) as follows ...
-
bioRxiv - Molecular Biology 2020Quote: ... The linkers were pre-adenylated with a 5’ DNA Adenylation kit (NEB), and then used for the ligation reaction ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 mM EDTA and 40 U/ml RNAse inhibitor (New England Biolabs) at 4 °C for 5 min to remove non-specifically associated proteins ...
-
bioRxiv - Genomics 2020Quote: ... and SalI (5’-GTCGAC-3’, New England Biolabs Inc., MA, CA#R3138S) restriction enzymes ...
-
bioRxiv - Molecular Biology 2021Quote: ... triplex reaction was treated with either 5 units of RNase H (NEB) or 10εg of RNase A (Life Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: ... phosphorylated by T4 polynucleotide kinase at the 5’ ends (NEB, Ipswich, MA) at 37°C for 30 min ...
-
bioRxiv - Genomics 2021Quote: ... augments Cap-specific 5’ adapter ligation by T4 RNA ligase 1(NEB). The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... A mix of 5 µL of 10X NEB2.1 buffer (New England Biolabs), 1.25 µL of 1 mM dATP ...
-
bioRxiv - Cell Biology 2021Quote: ... instead of dCTP and 5 U/μl Klenow fragment Dpol I (NEB) at 37°C for 2 h ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and A-tailed using Klenow (3′-5′ exo-; New England Biolabs M0212L). Illumina-compatible adapters were subsequently ligated to DNA ends ...
-
bioRxiv - Genetics 2020Quote: ... and 5 μl of 400 U/μl T4 ligase (NEB M0202S/L), and incubated for 4 hours at room temperature with rotation ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was degraded using 5 units RNase H (New England Biolabs M0297) for 30 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 μl of 10 U/μl T4 polynucleotide kinase (NEB; Cat#: M0201L), 1 μl of 5 U/μl Klenow DNA polymerase ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3.6 μl of 5 U/μl Klenow (exo-) (NEB; Cat#: M0212S). The reactions were carried out for 45 min at 37 °C in a PCR machine ...
-
bioRxiv - Systems Biology 2021Quote: ... Beads were resuspended at 5 µg µl-1 followed by MseI (NEB) digestion according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Dephosphorylated RNA was then 5’ end-labeled with 20U T4 PNK (NEB) and 30μCi [g32-P]ATP (Perkin-Elmer) ...
-
bioRxiv - Genomics 2021Quote: ... and A-tailed using Klenow Fragment (3’→5’ exo-) (New England Biolabs) followed by the ligation of NEXTFLEX® Bisulfite-Seq adapters ...
-
bioRxiv - Molecular Biology 2020Quote: ... A mix of 5 μl 3’Ligation Reaction Buffer 2x (NEB-kit) and 1.5 μl of 3’Ligation Enzyme Mix (NEB-kit ...
-
bioRxiv - Microbiology 2021Quote: ... and subsequently 5’-dephosphorylated with Calf intestinal alkaline phosphatase (New England Biolabs). CviAII cuts on a sequence motif ‘CATG’ which is highly frequent on bacterial genomes ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µl of sample was used in PCR with OneTaq polymerase (NEB) with primers Cas168 GGGACAGATACGCGTTTGAT and Cas169 GCCTAACTGAACGGTTTGA as described previously (31) ...
-
bioRxiv - Cell Biology 2021Quote: ... and tumbled with 5 μg of anti-m6A antibody (New England Biolabs) at 4°C overnight ...
-
bioRxiv - Biophysics 2020Quote: We used in vitro mutagenesis (Q-5 Site-directed Mutagenesis Kit, NEB) to introduce the mutations creating d isoforms using the following primers ...