Labshake search
Citations for New England Biolabs :
1251 - 1279 of 1279 citations for 7 Acetoxy 3 chromonecarboxaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... The digested DNA (4 ml in total) was split into 4 aliquots and diluted in 8 ml ligation buffer (1X ligation buffer NEB 3 (without ATP), 1 mM ATP ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1 µl murine RNase inhibitor per sample and 3 µl were added to each sample together with 2 µl truncated T4 polynucleotide kinase (#M0201, NEB; Frankfurt/Main, Germany). Samples were incubated for 2 h at 37°C and the enzyme was deactivated after the reaction by 10 min incubation at 75°C ...
-
bioRxiv - Neuroscience 2019Quote: ... We designed custom adaptors (Table S5) which were directly ligated to the 3’ ends of RNA using RNA ligase 1 (NEB Cat. No. M0437) and truncated RNA ligase KQ (NEB M0373) ...
-
bioRxiv - Zoology 2021Quote: ... a total of nine RNA libraries were prepared with 3 μg RNA using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Plant Biology 2021Quote: ... Detection of editing in the EBE region of CsLOB1 promoter was performed by amplifying the target region (primers in Supplementary Table 3) with high fidelity DNA polymerase Q5 (New England Biolabs, Ipswich, MA, USA), followed by cloning of PCR products and sequencing.
-
bioRxiv - Microbiology 2022Quote: ... We then used 1:3 insert to vector ratio in a 1 hour Hifi assembly reaction using NEBuilder HiFi DNA Assembly kit (NEB, Cat. No. E2621). After the HiFi assembly ...
-
bioRxiv - Molecular Biology 2023Quote: ... digoxigenin-11-ddUTP was added to the 3’ end of the digested fragments using terminal transferase enzyme (New England Biolabs, Ipswich, MA, USA).
-
bioRxiv - Microbiology 2023Quote: ... The upstream and downstream PCR products were designed to have an overlapping region of sequence to promote 3-part Gibson assembly (NEB Gibson assembly kit) and primers 5b and 4 had extensions to anneal to vector pMP62 ...
-
bioRxiv - Molecular Biology 2023Quote: All PolD mutants (Supplementary table 3) were generated using pLB047 and a Q5 Site-Directed mutagenesis kit (E0554 New England Biolabs Inc., Ipswich MA) as described by the manufacturer ...
-
bioRxiv - Genomics 2023Quote: ... This 17 µl of DNA solution was incubated with 3 µl digestion mixture containing 1 µl BciVI (New England Biolabs, cat. no. R0596S) and 2 µl CutSmart buffer (New England Biolabs ...
-
bioRxiv - Physiology 2024Quote: ... and PCR was performed with Flag F (caaggacgacgatgacaaagtc) + 3’OUTR (CAGAGCCAACAACGTGAGGT) primers using Q5® High-Fidelity DNA Polymerase (New England Biolabs, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The inserted barcoding sequences were annealed using randomized overlapping single stranded oligonucleotides by adding 3 µl of each oligonucleotide (100 µM) to 500 µl 1x 2.1 NEB-buffer (New England Biolabs, Ipswich, MA, USA, #B6002S) followed by boiling at 100 °C for 3 minutes to finally let them associate during the cooling to room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... hereafter called Flag-SERCA2-C) were constructed from 3×Flag-SERCA2 using a Q5 Site-Directed Mutagenesis Kit (New England BioLabs, Ipswich, MA, USA). mCherry-Sec61B (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... 3 ug RNA was treated with Promega RQ1 DNase (M6101) then cleaned up with the Monarch® RNA Cleanup Kit (NEB Biolabs, T2050S) and eluted in 30 µl dH2O.
-
bioRxiv - Microbiology 2020Quote: ... PCR protocols entailed an initial phase of 95° C for 3 min using Hot Start Taq polymerase (New England BioLabs Inc., Ipswich, MA, USA), followed by 35 cycles at 50°C and 52°C annealing temperatures for 16S and ITS amplicons respectively ...
-
bioRxiv - Neuroscience 2020Quote: ... Sequencing libraries were generated from a total amount of 3 μg RNA per sample using NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... 500 μl of lysed cells were transferred to a tube containing 4.5 ml of digestion mix (1X NEB 3 buffer, 1% triton X-100) and 100 μl of the lysed cells were transferred to a tube containing 0.9 ml of digestion mix ...
-
bioRxiv - Plant Biology 2022Quote: ... 250 μL 2× lysis buffer (20 mM Tris-HCl, 40 mM Na2EDTA, 1% (w/v) SDS) and 3 μL proteinase K (NEB: P8102S, 20 mg/mL) were added and incubated under agitation at 55°C for 2 h ...
-
bioRxiv - Genomics 2022Quote: ... and for the synthesis of the second strand of cDNA was used the Klenow fragment 3’-5’ exo (New England Biolabs Inc., Ipswich, MA, USA), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 µL 10x T4 ligase buffer, 3 µL 50 mg/mL BSA, 1.5 µL 2000U/µL T4 ligase, NEB, 6 µL BLISS adapter pairs). For removal of excess adapters ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were resuspended in 50 mL buffer 3 (20mM KPi pH 7.4, 1.2M Sorbitol, 10 mM ribonucleoside vanadyl complex (NEB S1402S, pre-warmed at 65 °C), 0.08mg/ml Zymolyase-20T (Amsbio 326921) ...
-
bioRxiv - Genomics 2024Quote: ... Samples were then rinsed with 2X SSC before incubating with a blocking buffer (10% BSA, 3% v/v 6% v/v murine RNase inhibitor [NEB, M0314L] in 2X SSC) for 30 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... 5’-GCT GCG TTC TTC ATC GAT GC-3’) were chosen with barcodes for PCR amplification using Phusion® High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, MA, USA). The PCR products were then mixed at equal density ratios and purified with a Gel extraction kit (QIAGEN ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 100 ng of DNA was cleaved with PstI HF and MseI restrictases in CutSmart® buffer (New England Biolabs; 3 hours at 37°C). P1 and P2 barcoded adapters corresponding to the restriction site of the enzymes were ligated immediately afterwards with T4 ligase (NEB ...
-
bioRxiv - Synthetic Biology 2021Quote: ... cells were washed once with PBS for 3 minutes and subjected to nuclear staining with Hoechst (New England BioLabs; 4082S; diluted 1:5000 in PBS) for 5 minutes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... cells were washed once with PBS for 3 minutes and subjected to nuclear staining with Hoechst (New England BioLabs; 4082S; diluted 1:5000 in PBS) for 5 minutes ...
-
bioRxiv - Genomics 2021Quote: ... The selected DNA fragments were end-repaired and 3’-adenylated with the NEBNext® Ultra™ II End Repair/dA-Tailing Module (New England Biolabs, Ipswich, MA, USA). The DNA was then purified with AMPure XP beads (Beckmann Coulter ...
-
bioRxiv - Biophysics 2023Quote: ... linker (listed in Supplemental Table S6) was ligated to the 3′ end using T4 RNA Ligase 2 truncated KQ (New England Biolabs #M0373, 400 units per sample) in T4 Ligase reaction buffer (New England Biolabs #B0216 ...
-
bioRxiv - Biochemistry 2022Quote: ... purified KRAS protein was mixed with GMP-PNP (molar ratio of 10:1 GMP-PNP:KRAS) and calf intestinal alkaline phosphatase (NEB cat# M0290, 3 units per mg of KRAS). The reaction mixture was incubated for 3 hours at room temperature and then purified by size-exclusion chromatography on a 10/300 Superdex 75 GL column (GE Healthcare ...