Labshake search
Citations for New England Biolabs :
1251 - 1300 of 4681 citations for 6 7 Dihydro 2 formyl 5H pyrrolo 1 2 a imidazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Amplified PCR products were ran on 2% agarose gel and stained with ethidium bromide solution (New England Biolabs Inc.). Gel photographs were taken using ChemiDoc MP gel documentation system (BIO-RAD).
-
bioRxiv - Microbiology 2023Quote: ... was ordered and cloned into the pCG1-SARS-2BA.2 vector via Gibson assembly according to the manufacturer’s instructions (New England Biolabs). To this end the pCG1-SARS-2-BA.2 vector was amplified by PCR using appropriate primers (GTGCCATTGGTGCCGGACACG and CACCAGCCTTACAGAGTGG ...
-
bioRxiv - Bioengineering 2023Quote: ... and assembled with PCR amplified (primers 2 and 3) pRSET vector fragment using Gibson assembly (NEB Japan, Tokyo, Japan) to add T7 promoter ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 0.5 μl of 100 mM phenylmethylsulfonyl fluoride] and incubated with micrococcal nuclease (2 × 103 U/ml; New England Biolabs) for 2 hours at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... Single cells of two untreated CeD patients were sorted into 96-well plates containing 2 µl of scRNA-seq catch buffer (0.2% vol/vol Triton X-100 [Sigma] in H2O with 2 U/μl RNase inhibitor [New England Biolabs]) per well using a FACSAriaIII instrument (BD) ...
-
bioRxiv - Immunology 2023Quote: ... and ligated with custom UMI adapters (IDT) (Table S2) at 2 uM according to NEBNext Ultra II instructions (NEB). Libraries were prepped following NEBNext Immune Sequencing Kit’s protocol (NEB) ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR products were digested with 0.4 μl of restriction enzyme NlaIII for 2 hours at 37°C (New England Biolabs). Digested PCR products were run on 2% agarose gels with SYBR Safe (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... for the elution from the columns 2 pg of Tn5-digested and purified lambda DNA (New England Biolabs, # N3011S) were added to be used as spike-in normalizer for later analysis ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells were fixed with 3% paraformaldehyde in PBS for 10 min at room temperature and permeabilized with ice-cold permeabilization buffer (1X-PBS, 0.5% Triton X-100, 2 mM vanadyl-ribonucleoside complex (New England Biolabs)) for 4 min on ice ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μL i7 unique index primer (10 μM) and 25 μL NEBNext High-Fidelity 2X PCR Master Mix (NEB) were added to 21 μl of purified CUT&TAG DNA ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 20 µL of denatured protein lysate was combined with 2.6 µL of 10X GlycoBuffer 2 (Cat.#B3704S; New England Biolabs), 2.6 µL of 10% NP-40 (Cat.#B2704S ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µL of isolated phage T4 in Pi-Mg buffer was used as a PCR template in the first PCR with the following reaction mix: 0.125 µM each primer (Supplementary Table 2) in 1x High Fidelity Master Mix (NEB) with a total volume of 10 µl ...
-
bioRxiv - Neuroscience 2024Quote: ... Input genomic DNA was first amplified in a 10μL reaction for 30 cycles using NEBNext High-Fidelity 2×PCR Master Mix (NEB). Amplicons were purified using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2023Quote: Protein G magnetic beads were washed 2-3x with 1ml blocking buffer (20 mM Hepes, 150 mM KCl, 20% Glycerol, 0.5 % Tween, BSA (Biolabs), Heparin 0.2 mg/ml ...
-
bioRxiv - Bioengineering 2024Quote: ... The RNA template of the SARS-CoV-2 N gene was synthesised using in-vitro transcription (Hiscribe, NEB, US) and a template plasmid (Molecular Diagnostics Collection ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR reactions contained 2 μl cDNA in 50 μl PCR reaction with Phusion Hot Start Flex (New England Biolabs). Reaction conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μL of PURExpress sample was mixed with 300 ng of ΦX174 Virion DNA (ssDNA substrate, NEB Ipswich MA) or ΦX174 RF I DNA (dsDNA substrate ...
-
bioRxiv - Microbiology 2020Quote: ... 6 µg of DNA was used for MmeI digestion in 200 µL (6 µg gDNA, 6 µL MmeI (2000 U/mL, NEB), 0.5 µL 32 mM S-adenosylmethionine ...
-
bioRxiv - Synthetic Biology 2022Quote: ... A fraction (6 μL) of the eluate was mixed with an equal volume of 6× purple gel loading dye (NEB) and loaded in 1% agarose gel with ethidium bromide ...
-
bioRxiv - Immunology 2023Quote: ... was biotinylated with sulfosuccinimidyl-6-[biotinamido]-6-hexanamido hexanoate (sulfo-NHS-LC-LC biotin; ThermoScientific) and coupled to streptavidin beads (New England Biolabs). Patient samples were incubated with RBD-coupled beads and excess sera washed off with PBS (Sigma) ...
-
Direct analysis of ribosome targeting illuminates thousand-fold regulation of translation initiationbioRxiv - Molecular Biology 2020Quote: ... Gel-purified cDNA products were ligated to the adapter oWG920 (Supplementary Table 6) using T4 RNA ligase 1 (NEB M0437M). cDNA cleanup was performed using 10 µl MyOne Silane beads (Thermo Scientific 37002D ...
-
bioRxiv - Synthetic Biology 2020Quote: ... All digested products were column purified and mixed at a 6:1 molar ratio in the presence of T4 DNA ligase (NEB).
-
bioRxiv - Biochemistry 2021Quote: ... 150 μl of the remaining sample was mixed with 6 μl (1 μl per 25 μl sample volume) of Thermolabile Proteinase K (NEB), incubated at 37 °C for 30 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... were PCR-amplified using primers that contained restriction sites for EcoRI and SacI (Table S5, primers No. 1-6) and the high-fidelity polymerase Q5 (New England Biolabs) according to vendor’s manual ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cDNA was synthesized from 1 μg of total RNA using M-MuLV Reverse Transcriptase and Random Primers 6 (both New England Biolabs) at 42 °C for 60 min and diluted in 1:4 ratio by PCR grade water ...
-
bioRxiv - Plant Biology 2020Quote: ... for sgRNA-LecRK-I.1 and pMR218 (L5-L2) for sgRNA-LecRK-I.6 via a cut-ligation reaction with BbsI (New England Biolabs) and T4 DNA ligase (New England Biolabs) ...
-
bioRxiv - Genomics 2020Quote: ... and half of the DNA was 3’-end labeled for 1 h at 37 °C in a 10-μl reaction containing 6 units of terminal deoxynucleotidyl transferase (New England Biolabs), 0.25 mM CoCl2 ...
-
bioRxiv - Biochemistry 2023Quote: ... The products were purified using the Zymo Research kit and eluted with 6 uL water and 1 uL was electroporated into DH10B cells (NEB). Electroporated cells were recovered in 975 uL of LB and plated on LB agar containing carbenicillin (100 μg/ml ...
-
bioRxiv - Genomics 2019Quote: ... and 6 µL Klenow (5 U/µL, NEB), and DNA blunting was carried out for 1 h at room temperature with shaking at 800 rpm ...
-
bioRxiv - Genomics 2019Quote: ... and 6 μl USER enzyme (New England Biolabs). The reaction was incubated at 37°C for three hours ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 6 μl 10mM ATP (New England Biolabs). Linear DNA was then digested by 30 minute incubation at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... and 6 μM of random hexamer primer (NEB). cDNA was amplified with Taq DNA polymerase (NEB ...
-
bioRxiv - Genetics 2020Quote: ... 6 μl 20 mg/ml BSA (NEB B9000S), and 5 μl of 400 U/μl T4 ligase (NEB M0202S/L) ...
-
bioRxiv - Microbiology 2022Quote: ... 6 U Bst 2.0 WarmStart DNA polymerase (NEB), and 2.25 U WarmStart® RTx Reverse Transcriptase (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... 4 mM MgSO4 (NEB; final, 6 mM Mg2+), 1 mM each dNTP (Enzynomics) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 6 U/ml Thermolabile proteinase K (NEB). The barcoded PAAm beads were prepared for encapsulation as previously described (Zilionis et al. ...
-
bioRxiv - Microbiology 2023Quote: ... 6 µL of Proteinase K (New England Biolabs) was added to the cell resuspension ...
-
bioRxiv - Microbiology 2024Quote: ... 6 μl of 50% PEG 8000 (NEB B1004A), 40 units of Ribolock RNase inhibitor EO0382)] ...
-
bioRxiv - Genomics 2023Quote: ... nuclei from 2 million MCF-7/NA12878 cells at a viability of ∼95% were resuspended in 200 μl of reaction buffer (1× NEB CutSmart buffer, 0.3 M sucrose). Nuclei were then treated with EcoGII by adding 200 U of EcoGII (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... The samples were transferred to 7 ml of 1.15x T4 ligation buffer (NEB), incubated with 1% Triton X-100 for 1 hour at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... Cas9 was diluted to 7 μM with diluent buffer B (NEB, Ipswich USA) on arrival and stored at −20 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were incubated at 37°C and stopped for indicated time periods and the reaction was stopped by addition of 2 × RNA loading dye (New England Biolabs). For electrophoresis ...
-
bioRxiv - Genetics 2021Quote: ... input genomic DNA was amplified in a 20 μL reaction for 25 cycles using NEBNext High-Fidelity 2× PCR Master Mix (NEB). PCR products were purified using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2021Quote: ... The protein was buffer exchanged into enterokinase cleavage buffer (20 mM Tris pH 8, 50 mM NaCl, 2 mM CaCl2) and cleaved using bovine enterokinase (EK, NEB) at 16U/mg protein for 4 hrs ...
-
bioRxiv - Microbiology 2020Quote: ... This gBlocks fragment and a NdeI-HindIII-digested pET21b backbone were assembled together using a 2× Gibson master mix (NEB). Gibson assembly was possible due to a 23-bp sequence shared between the NdeI-HindIII-cut pET21b backbone and the gBlocks fragment ...
-
bioRxiv - Microbiology 2020Quote: ... Two and a half μL of each fragment at equimolar concentration was added to 5 μL 2× Gibson master mix (NEB), and the mixture was incubated at 50°C for 60 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA (2 μL) was used as template in 50 μL PCR reaction with Phusion Hot start flex (New England Biolabs). Reaction conditions ...
-
bioRxiv - Genomics 2020Quote: ... Beads containing the ssDNA extension products were suspended in 10 μl of polyadenylation master mix containing 2 units of terminal transferase TdT (New England Biolabs), 1x TdT buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... The lenti-sgRNA puro vector was digested with EcoRI for 2h at 37°C followed by digestion with BsmBI for 2 hours at 55°C and treatment with 4 μl of rSAP (NEB) for 1 hour at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAse I digestion to analyse 2’-O-ribose methylation was done in the presence of 10 U T4 PNK (NEB) in 50 mM Tris-acetate (pH 6.5) ...