Labshake search
Citations for New England Biolabs :
1251 - 1300 of 5823 citations for 5M Betaine Solution PCR Grade since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... and NEBNext High-Fidelity 2X PCR Master mix (New England Biolabs) with 12 cycles ...
-
bioRxiv - Genomics 2020Quote: ... 25 µl 2x NEBNext High-fidelity PCR mix (New England Biolabs), and 15 µl H2O ...
-
bioRxiv - Molecular Biology 2020Quote: ... Polymerase chain reactions (PCRs) were performed using Phusion DNA polymerase (NEB) according to manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2021Quote: ... The PCR product was transcribed using the T7 IVT Kit (NEB), followed by DNase I (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... and purified using the Monarch PCR & DNA Cleanup Kit (NEB, T1030L). The source of the 3xHA-Nluc starting CDS (“Nluc start” ...
-
bioRxiv - Synthetic Biology 2021Quote: ... followed by purification with Monarch® PCR & DNA Cleanup Kit (NEB). The Mobius Assemblies were verified first by colony PCR using GoTaq® Green Master Mix (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... The 25□µL final reaction volume contained 1X PCR Buffer (NEB), 3□mM MgCl2 ...
-
bioRxiv - Genetics 2020Quote: ... PCR fragments were amplified using Phusion polymerase (New England Biolabs M0530). Plasmids were digested with restriction enzymes at 37°C for 2-16hrs ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... All PCR amplification steps were done using Q5 polymerase (NEB, M049L) and TOP10 chemically competent E ...
-
bioRxiv - Genomics 2021Quote: ... and 25 µl 2x NEBNext Hi-Fi PCR mix (NEB, USA) per reaction ...
-
bioRxiv - Physiology 2021Quote: ... Each PCR product was run alongside a 100bp DNA ladder (BioLabs) compared with positive and negative controls.
-
bioRxiv - Microbiology 2021Quote: ... Purified PCR product was digested with BsaHI RE enzyme (NEB, UK), as per the manufacturer"s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... The cDNA sequence was PCR amplified using Phusion enzyme (NEB, M0530S) and appropriate primers with overhangs for Not1 and Kpn1 restriction enzymes (sequences given in Supplementary Table 2) ...
-
bioRxiv - Evolutionary Biology 2020Quote: PCR was performed on cDNA using Q5 High-Fidelity Polymerase (NEB). The K1 ORF was amplified using primers M1_F1 or M1_F5 and M1_R6 (Table S3) ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR fragments were amplified using Q5 polymerase (New England Biolabs, NEB). DNA fragments were isolated using the Qiaprep spin miniprep kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR fragments were amplified using Q5 polymerase (New England Biolabs, NEB). DNA fragments were isolated using the Qiaprep spin miniprep kit (Qiagen) ...
-
bioRxiv - Plant Biology 2021Quote: ... Amplicons were purified with Exo-CIP Rapid PCR Cleanup Kit (NEB) following supplier’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The 2810-bp PCR product was phosphorylated with polynucleotide kinase (NEB) and circularized with T4 DNA ligase (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... or the Exo-Cip Rapid PCR Cleanup Kit (New England Biolabs). Gene editing efficiency was analyzed using TIDE analysis software (Brinkman et al ...
-
bioRxiv - Cell Biology 2021Quote: ... EJ5-GFP insertion was verified by PCR (OneTaq, New England Biolabs). CHO-K1 ATM+ was generated by transfecting a clonal population of CHO-K1 EJ5-GFP with a Cas9:tracrRNA:sgRNA ribonucleoprotein particle (Integrated DNA Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: ... all PCR products were generated with Phusion polymerase (New England Biolabs). All plasmids were sequence-verified.
-
bioRxiv - Plant Biology 2022Quote: ... the amplified PCR products were digested using DpnI (New England Biolabs) and transformed into DH5a competent cells ...
-
bioRxiv - Plant Biology 2022Quote: ... the amplified PCR products were digested using DpnI (New England Biolabs) and transformed into DH5a competent cells ...
-
bioRxiv - Cell Biology 2021Quote: ... and used as DNA template for PCR with Phusion Polymerase (NEB) or Q5 Polymerase (NEB ...
-
bioRxiv - Genetics 2021Quote: ... PCR fragments were amplified using Phusion polymerase (New England Biolabs (NEB), M0530 ...
-
bioRxiv - Genetics 2021Quote: ... PCR fragments were amplified using Phusion polymerase (New England Biolabs (NEB), M0530 ...
-
bioRxiv - Genomics 2021Quote: ... The cDNA was PCR amplified with NEB Q5 HotStart polymerase (NEB) using splicing assay primers from IDT (AGACCCAAGCTGGCTAGCGTT forward ...
-
bioRxiv - Immunology 2020Quote: ... PCR-amplified fragments were digested with XbaI and XhoI enzymes (NEB) and cloned into the NheI and SalI sites of pCW57-MCS1-P2A-MCS2 (Hygro ...
-
bioRxiv - Immunology 2020Quote: ... PCR-amplified fragments were digested with NheI and SalI enzymes (NEB) and cloned into the NheI and SalI sites of a pCW57.1 vector ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were digested with restriction enzyme XmaI (New England Biolabs) and ligated with T4 DNA ligase (New England Biolabs) ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR step was carried out by Taq DNA polymerase (NEB) using forward primer identical to the adapter sequence (Table S1 ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was PCR-amplified using either Phusion (New England Biolabs; NEB), Pfu (Agilent) ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was PCR-amplified using either Phusion (New England Biolabs; NEB), Pfu (Agilent) ...
-
bioRxiv - Microbiology 2021Quote: ... cleaned up using the Monarch PCR Purification kit (New England Biolabs), and used in a Gibson assembly reaction (New England Biolabs ...
-
bioRxiv - Microbiology 2020Quote: PCR fragments were digested with BsaI or BsmBI restriction enzyme (NEB) to specific sticky end ...
-
bioRxiv - Immunology 2020Quote: PCRs were performed with Q5 High-Fidelity DNA polymerase (NEB, M0491L) in 8 parallel 50ul reactions with the following cycle conditions ...
-
bioRxiv - Microbiology 2021Quote: PCR amplicons and plasmids were purified using Monarch DNA kits (NEB). PCR ...
-
An atlas of neural crest lineages along the posterior developing zebrafish at single-cell resolutionbioRxiv - Developmental Biology 2020Quote: ... and dla were amplified via high fidelity Phusion-HF PCR (NEB) from 48 hpf AB WT cDNA libraries using primers in the Key resources table ...
-
bioRxiv - Cell Biology 2021Quote: ... The amplified PCR product was then cut using restriction enzymes (NEB) and ligated to linearized vector pGex-6p-1 (GST ...
-
bioRxiv - Cell Biology 2021Quote: ... fragments were PCRs amplified with Phusion DNA Polymerase (New England Biolabs) and were assembled by T4 ligase (New England Biolabs ...
-
bioRxiv - Genomics 2021Quote: ... and DNA cleaned with Monarch PCR & DNA Cleanup Kit (NEB T1030S). Resulting supercoiled plasmid is linearized at the 3’ end of the PolyA tail using BamHI-HF (NEB R3136S) ...
-
bioRxiv - Genetics 2020Quote: ... PCR was conducted using OneTaq 2x Master Mix (New England Biolabs) with forward and reverse primers following the program of 95°C×10min ...
-
bioRxiv - Biophysics 2021Quote: ... a 2.4 mL PCR reaction was performed using Taq polymerase (NEB) in 1X GoTaq buffer to amplify a 25-N-43 DNA ...
-
bioRxiv - Microbiology 2021Quote: ... the two fragments were generated using Phusion PCR (New England Biolabs) by amplifying the TurboGFP open reading frame from the vector pGIPZ (Thermo Scientific Open Biosystems ...
-
bioRxiv - Synthetic Biology 2023Quote: ... with DNA fragments obtained by PCR with the Q5 polymerase (NEB) [21] ...
-
bioRxiv - Microbiology 2023Quote: ... Multiplex PCR reactions were performed using Q5 polymerase (New England Biolabs) under the following cycling conditions on a Bio-Rad T100 thermal cycler ...
-
bioRxiv - Microbiology 2023Quote: Routine PCR was performed using Q5 High-fidelity Mastermix (NEB M0492L). PCR purification and gel extraction was performed using Macherey-Nagel Kit cat ...
-
bioRxiv - Microbiology 2023Quote: ... PCR amplifications were performed with Q5 DNA polymerase (NEB, MA, USA) and assembly was performed using the HiFi DNA assembly master mix (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... we performed PCR with Q5 Hot Start High-Fidelity (NEB M0494S), column purification with QIAquick PCR Purification Kit (Qiagen 28104) ...
-
bioRxiv - Bioengineering 2023Quote: ... PCR amplified (Q5 HotStart DNA polymerase (NEB, Cat. No./ID: M0493L)) ...