Labshake search
Citations for New England Biolabs :
1251 - 1300 of 2409 citations for 4 Chloro 2 methoxy N 2 4 methoxy phenyl ethyl benzamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... was PCR amplified (495bp) and cloned into the Lucia vector (Supplementary Figure 4) using ApaI and BamHI restriction enzymes (NEB, Catalog no ...
-
bioRxiv - Biochemistry 2023Quote: Genomic DNA was extracted from ∼4 million N2A cells and fragmented with restriction enzymes (BsrGI, EcoRI, HindIII, SspI, XbaI, 30 U/each, NEB) following a published protocol (89) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and size selected by running samples on a 1.8% LMT agarose gel at 120 V for 25 minutes at 4°C and gel extracting the mononucleosome band with a Monarch Gel Extraction Kit (T1020S, New England Biolabs). Purified samples were carried forward for qPCR or library preparation ...
-
bioRxiv - Genomics 2023Quote: ... 30 minutes at 72°C and finally held at 4°C until 1 μl Exonuclease I (20U/μl, catalog num. M0293S, NEB) was added to each sample ...
-
bioRxiv - Biochemistry 2023Quote: ... Clarified lysates were incubated for 1 hour at 4 °C on a nutator with 40 µL amylose resin slurry (New England Biolabs) equilibrated with amylose wash buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... The duplex hRNase 4 cleavage products (5′ fragments of the RNA) were enriched using Hydrophilic Streptavidin Magnetic Beads (New England Biolabs). The beads were washed twice by a high salt buffer (5 mM Tris HCl ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein blots were incubated with primary antibodies overnight at 4°C using the above-mentioned antibodies and the Gaussia Rabbit Polyclonal Antibody (E8023S, New England BioLabs), the Influenza A NS1 Mouse Monoclonal Antibody (sc-130568 ...
-
bioRxiv - Biochemistry 2024Quote: ... Synthesized cDNA was then diluted 4-fold and 1 μL was used as template for real-time qPCR using Luna Master Mix (NEB). Values were normalized to GAPDH ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The target genomic locus was amplified with the primers listed in Supplementary Table 4 using the Q5 Hot Start High-Fidelity Polymerase (NEB). Editing frequencies were assessed by T7E1 assay or targeted amplicon sequencing ...
-
bioRxiv - Plant Biology 2024Quote: ... The reaction mixtures were incubated for 1 h at room temperature and mixed with 4 μL of 6X gel loading dye (New England Biolabs). Following electrophoresis in 1.2% agarose gel containing SYBR safe DNA gel stain (Thermo Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... slides were rinsed three times with deionized water for 5 minutes and incubated in 1x Terminal Transferase (TdT) buffer containing 1X buffer 4 (NEB) and 2.5 μM CoCL2 for 10 minutes at room temperature in a humid chamber ...
-
bioRxiv - Neuroscience 2024Quote: ... The beads were washed three times with PNK wash buffer and the RNA-protein complexes labeled with 32P with the following reaction: 4 μl 10X PNK buffer (NEB), 2 μl T4 PNK enzyme ...
-
bioRxiv - Biochemistry 2024Quote: ... Ig3-4 was purified using the same method as Ig3/Ig4 with the addition of an amylose column (New England Biolabs) chromatography step to remove the MBP tag prior to cation exchange ...
-
bioRxiv - Genomics 2024Quote: ... samples between 4 and 24 mol/µl were amplified by selective whole genome amplification (sWGA) using the enzyme phi29 DNA Polymerase (NEB) before the genotyping ...
-
bioRxiv - Genomics 2024Quote: The efficacy of the methylation protocol was verified by methylation of a control library (CL) (Table 4) followed by enzymatic digestion using BstBI (NEB). 1 μg of both modified and unmodified CLs were mixed with 1 μl enzyme ...
-
bioRxiv - Biochemistry 2024Quote: ... was incubated in a reaction volume of 50 µl at 37°C for 18 h with 10 U of T4 beta-glucosyltransferase (T4-BGT) in the presence of 80 µM UDP-glucose in NEBuffer 4 (all New England Biolabs). Control reactions were incubated without T4 beta-glucosyltransferase ...
-
bioRxiv - Biochemistry 2024Quote: ... and the amount of AP activity in the supernatant and lysates was measured at an absorbance of 405 nm over a 90-minute time course following the addition of 1 mg/mL 4-nitrophenyl phosphate (New England Biolabs), using a BioTek SynergyH1 microplate reader ...
-
bioRxiv - Cell Biology 2024Quote: ... Eluted protein was detected via Bradford assay and immediately applied to a 1 mL amylose column at 4°C (New England Biolabs) at 10-15 ml/hr that was pre-equilibrated with nickel elution buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... Nuclei were pelleted at 7200rpm for 2min at 4℃ and washed once with cold 1.4× NEB buffer 3.1 (NEB Cat#B7203S). Nuclei were then re-suspended in 25μl of 1.4× NEB buffer 3.1 containing 0.1% SDS and incubated at 65℃ for 10min ...
-
bioRxiv - Biophysics 2021Quote: ... the SNAP-tag fragment was digested from the pSNAP-tag (T7)-2 vector (New England Biolabs), inserted into pET-28b plasmid resulting in a construct referred as pET-SNAP ...
-
bioRxiv - Cell Biology 2020Quote: ... and 2) the insert and pcDNA5-FRT-TO were digested with 40U of EcoRV-HF (NEB) and 40U of XhoI (NEB).
-
bioRxiv - Cell Biology 2020Quote: ... peak fractions pooled and reacted with 2-molar excess SNAP-substrate Alexa-488 dye (S9129, NEB) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Molecular Biology 2021Quote: ... The nuclei were harvested and resuspended in 0.5ml cold 1.2x NEB Buffer 2 (New England Biolabs), incubated with 0.3% SDS for 1 hr at 37°C ...
-
bioRxiv - Genomics 2022Quote: ... 10 μl 2X Quick T4 ligase buffer and 2 μl Quick T4 DNA ligase (NEB, M2200L) were added to the reaction and incubate at 37 °C for overnight ...
-
bioRxiv - Genomics 2020Quote: ... 66U/μl truncated T4 ligase 2 and 13U/μl murine RNAse inhibitor (all from NEB, USA)) were added to the aRNA/adapter solution ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ...
-
bioRxiv - Developmental Biology 2021Quote: ... 10 µl of PCR product was then mixed with 1.5 µl 10X NEBuffer 2 (B7002S, NEB) and 1.5 µl of Nuclease-free water ...
-
bioRxiv - Biochemistry 2021Quote: ... This was added to 5 ml (per 2 L of culture) amylose resin (New England Biolabs) equilibrated in lysis buffer and left on a tube roller shaker at 4 °C for 1 h ...
-
bioRxiv - Plant Biology 2021Quote: ... using BamHI and XhoI restriction sites and 2× Gibson Assembly master mix (NEB, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.4 units μL−1 T7 RNA polymerase (RNAP, NEB 2 units μL−1 RNase inhibitor (NEB), 50 nM Cas9 (NEB) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.4 units μL−1 T7 RNA polymerase (RNAP, NEB 2 units μL−1 RNase inhibitor (NEB), 50 nM Cas9 (NEB) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Vcan exon 2 and exon 3 were amplified using Phusion Taq (NEB, catalog no. F530L) (see SI) ...
-
bioRxiv - Microbiology 2021Quote: ... For reverse transcription (RT) 1 µg RNA was digested with 2 U of DNase I (NEB). After heat inactivation of the DNase at 70 °C for 5 min ...
-
bioRxiv - Microbiology 2022Quote: ... a sequencing library was constructed with the NEBNext ARTIC SARS-CoV-2 FS kit (NEB E7658S). For each viral variant ...
-
CRISPR-Cas9-mediated knockout of CYP79D1 and CYP79D2 in cassava attenuates toxic cyanogen productionbioRxiv - Plant Biology 2021Quote: ... 2 µL of cDNA mix was added to 50 µL Phusion High-Fidelity DNA Polymerase (NEB) reaction mix ...
-
bioRxiv - Immunology 2021Quote: ... and SARS-CoV-2 RBD were conjugated to SNAP-Capture Pull-Down resin (New England BioLabs). For each conjugation ...
-
bioRxiv - Cancer Biology 2020Quote: ... The pulse step was performed with 2 µM SNAP-cell TMR Star (New England Biolabs, S9105S) for 15 min followed by two washes with medium ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM 3’-O-Me-m 7G(5’)ppp(5’)G cap structure analog (NEB S1411S), 0.5 mM GTP ...
-
bioRxiv - Cell Biology 2022Quote: ... after which 2 µL of Recombinant PNGaseF (Glycerol-free) (New England Biolabs, Ipswich, MA; catalog # P0709L) was added to each sample ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR was performed with Q5 Hot Start High-Fidelity 2 × Master Mix (#M0494L, New England Biolabs) with the amount of input genomic DNA (gDNA ...
-
bioRxiv - Genetics 2020Quote: ... 10 μL re-annealed PCR product was digested with 2 units T7 Endonuclease I (NEB #M0302L) in NEBuffer 2 for 60 min at 37°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Ligation was performed by adding 1 unit of T4 RNA Ligase 2 enzyme (New England Biolabs) in 10 μl of 1X reaction buffer and incubating the reaction at 37°C for 60 min ...
-
bioRxiv - Immunology 2021Quote: ... PCR reaction was performed using OneTaq® 2× Master Mix with Standard Buffer (New England Biolabs). Primers sequences ...
-
bioRxiv - Molecular Biology 2020Quote: ... and then inserted into pU6-2-gRNA plasmids using T4 DNA ligase (New England Biolabs # M0202S).
-
bioRxiv - Molecular Biology 2021Quote: ... Long (HMSpAa) and short (HMSpBb) splinkerette adaptors were first resuspended with 5X NEBuffer 2 (NEB, B7002) to reach a concentration of 50uM ...
-
bioRxiv - Molecular Biology 2022Quote: ... Chromosomal and plasmidic DNA was removed by treatment with 2 units of DNase1 (New England Biolabs) for 2 hours at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... and barcoded using NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 & 2; New England Biolabs). Number of PCR cycles was calculated using a real-time qPCR-based approach (Lion et al. ...
-
bioRxiv - Genomics 2022Quote: ... a 2 μl mix of 6.4 U of Exo I (New England Biolabs, Ipswich, MA, USA), 32 U of Exo III (New England Biolabs ...
-
bioRxiv - Genomics 2022Quote: ... 2 μL of 10 mM i5 primer and 25 μL of 2x NEBNext Master Mix (NEB). The following PCR conditions were used ...