Labshake search
Citations for New England Biolabs :
1201 - 1221 of 1221 citations for Mouse Anti Crimean Congo Hemorrhagic Fever Virus Gn Protein JE12 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... sgRNA-hKCTD5 sense CACCGCGAGCTCCTGTCGCCGGCC and sgRNA-hKCTD5 anti-sense AAACGGCCGGCGACAGGAGCTCGC followed by phosphorylation of the double-stranded DNA by T4 kinase (NEB). The sgRNA was cloned into pX330 (a generous gift from S ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were separated through SDS-PAGE and transferred to a PVDF membrane followed by incubation with anti-MBP monoclonal antibody (E8032S, NEB) and M2 Flag antibody (A8592 ...
-
bioRxiv - Molecular Biology 2024Quote: ... the reaction was started in the absence of GTP and in the presence of 0.5 mM of anti-reverse m7G-cap analog (NEB #S1411) for 10 min ...
-
bioRxiv - Immunology 2022Quote: ... The plates were subsequently fixed using 5% formaldehyde and immuno-stained using a monoclonal anti-SARS-CoV-NP antibody (Creative-Biolabs; NP1C7C7). In brief ...
-
Systematic Analysis of Lysine Succinylation in Vero cells infected with Small Ruminant MorbillivirusbioRxiv - Genomics 2021Quote: ... 72 h post infection (hpi) and analysed by western blotting and pan anti-succinyllysine antibody (PTM-419, PTM Biolabs, Hangzhou, China), and non-inoculated cells served as control group ...
-
bioRxiv - Biochemistry 2021Quote: ... RNA was synthesized as described (Schäfer et al., 2018) in the presence of anti-reverse cap analog (NEB or Jena Biosciences) and gel-purified ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was transcribed into mRNA which was co-transcriptionally capped with the Anti-Reverse Cap Analog (ARCA) 3′-O-Me-m7G(5′)ppp(5′)G (NEB # S1411) using the HiScribe T7 High Yield RNA Synthesis Kit (NEB # E2040) ...
-
bioRxiv - Microbiology 2024Quote: ... The membrane was incubated for 1 hour in the presence of an anti-SNAP-tag primary antibody (New England Biolabs #P9310S) diluted at 1:2000 in PBS + tween-20 0.1% ...
-
bioRxiv - Neuroscience 2021Quote: ... and then incubated for 30 minutes in PBS containing the primary antibodies: rabbit polyclonal anti-lactyllysine antibody (PTM-1401, PTM Biolabs, Hangzhou, China), mouse monoclonal anti-tubulin β3 (801201 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Antibodies were diluted in the same Triton X 100 and BSA solution and suppliers and source were: primary 1:200 anti-CK20 rabbit D9Z1Z (New England Biolabs, Herts, UK), anti-CD31 mouse JC70/A (Abcam ...
-
bioRxiv - Plant Biology 2022Quote: ... The membranes were washed with TBS and incubated with a horseradish peroxidase (HRP)-conjugated anti-MBP monoclonal antibody (New England Biolabs; 1:5000).
-
bioRxiv - Cell Biology 2022Quote: ... SNAP-GLP-1R and SNAP-GIPR were detected with an anti-SNAP-tag rabbit polyclonal antibody (P9310S, New England Biolabs, 1/1,000) followed by goat anti-rabbit HRP secondary (ab6271 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Membranes were incubated overnight at 4 °C with the appropriate antibody: rabbit monoclonal anti-GSK3β (1:1,000; product # 9315, Cell Signalling Technology, New England BioLabs, Whitby, Ontario, Canada), rabbit polyclonal anti-p[Ser9]GSK3β (1:500 ...
-
bioRxiv - Plant Biology 2021Quote: ... Immunoprecipitation experiments were performed with 15 μL of Pan anti-glycine lysine antibody conjugated to agarose beads (PTM Biolabs, Chicago, IL, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.1% Tween) with 3% BSA and then incubating the strips in 1:2000 dilution of monoclonal anti-MPB-HRP antibody (NEB, Inc, USA) in a blocking buffer for 1 h at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein samples were resolved on an 12% SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membrane for detection with the following antibodies: anti-Glucocorticoid Receptor D6H2L (1:1000 dilution, Cell Signaling, New England BioLabs #12041), anti-PAX7c (1:500 dilution ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The expression of each engineered component was validated pre- and post-sort by staining Jurkat cells with an anti-Myc antibody (#2233S, NEB, MA, USA), followed by performing flow cytometry on a FACSCanto (BD Biosciences) ...
-
bioRxiv - Microbiology 2021Quote: ... The RNAs were co-transcriptionally capped with m7G anti-reverse cap analog or ApppG Cap Analog (New England Biolabs, 1411 and Cat#1406). The RNAs were purified using a Purelink RNA Mini Kit (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... Histone extracts were then resolved on a 15% polyacrylamide gel and Kac levels were determined with Western blot using anti-acetyllysine antibody (PTM Biolabs, Cat# PTM-101), with anti-Knbu/Kibu as the positive control using anti-butyryllysine antibody (PTM Biolabs ...
-
bioRxiv - Plant Biology 2022Quote: ... The precipitates and one-fifth of the supernatant were boiled in SDS loading buffer and subjected to western blot analysis using an anti-MBP monoclonal antibody (New England Biolabs, E8032S, 1:200 dilution), followed by anti-mouse IgG-HRP (Sigma ...
-
bioRxiv - Physiology 2020Quote: ... Membranes were washed with TBS-T and then incubated with an anti-rabbit horseradish peroxidase conjugated secondary antibody (New England Biolabs, 1:10,000 in 5% skim milk in TBS-T) for 2h ...