Labshake search
Citations for New England Biolabs :
1201 - 1250 of 2640 citations for 4 METHANESULPHONYLBUTAN 2 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... the following were added into each reaction tube: 0.5 μL of 10x buffer 4 (NEB), 0.5 μL of 1 mg/mLbovine serum albumin solution (NEB) ...
-
bioRxiv - Immunology 2020Quote: The I53-50A and I53-50B.4.PT1 proteins were expressed in Lemo21(DE3) (NEB) in LB (10 g Tryptone ...
-
bioRxiv - Cancer Biology 2021Quote: ... the PCR product was incubated for 4 hours with 2uL DpnI (NEB, Cat. No R0176), at 37°C ...
-
bioRxiv - Immunology 2019Quote: ... Three hundred nanograms of genomic DNA was mixed with 3 μl of buffer 4 (NEB), 0.5 μl of UDP-6-N3-Glu (0.3 mM) ...
-
bioRxiv - Biochemistry 2019Quote: ... 4 μg of plasmid was treated with 1U Klenow Fragment (3’ to 5’ exo-, NEB) for 10 min at 37°C to fill any remaining gapped plasmid 12 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The second strand was synthesized with 4 U of T7 DNA polymerase (New England BioLabs) and purified with HighPrep PCR beads (MagBio) ...
-
bioRxiv - Molecular Biology 2020Quote: ... each with 1 μg of gDNA first being digested with 4 U of MmeI (NEB) for 2 hours at 37 °C ...
-
Structure and mechanism of a Type III CRISPR defence DNA nuclease activated by cyclic oligoadenylatebioRxiv - Biochemistry 2019Quote: ... After adding 4 μl 6x DNA loading dye (New England BioLabs, Ipswich, MA, United States), 10 μl sample was analysed by 0.7% native agarose gel electrophoresis ...
-
bioRxiv - Developmental Biology 2021Quote: ... and the fragments were ligated over night at 4°C with T4 DNA Ligase (NEB) and heat shock transformed into DH5α competent E ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μL 10× Poly(A) Polymerase Reaction Buffer and 1 μL Poly(A) Polymerase (NEB) for poly(A ...
-
bioRxiv - Microbiology 2022Quote: ... PCR master mix reagents (see Figure 4): Taq polymerase and 10X Reaction Buffer (NEB M0273S), nucleotide mix containing 10 mM dTTP ...
-
bioRxiv - Molecular Biology 2022Quote: ... 250ng of genomic DNA was digested with the 4-base cutter MnlI (NEB, Ipswich, MA), overnight at 37°C according to manufacturer’s recommendations ...
-
bioRxiv - Bioengineering 2023Quote: ... Frozen cell pellets were resuspended in 4 mL of IMAC buffer (NEB, Ipswich, MA, USA) on ice and dispersed using an ultrasonic disruptor (Sonics ...
-
bioRxiv - Genomics 2023Quote: ... and ligated for 4 hours using 2000 U T4 DNA ligase (New England Biolabs, M0202L). Subsequently ...
-
bioRxiv - Cancer Biology 2023Quote: ... A negative control treated for 4 hours at 37 °C with RNaseH1 (New England Biolabs) was included for each condition ...
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: ... Plugs were rinsed with TE and then washed with 1 ml NEB buffer 4 (NEB) 3 × 15min ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 ug from each cell line was digested with 25 units EcoRI (New England Biolabs) in 100 ul total volume ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... 0.75 M NaCl) and 2 μl protein kinase K (NEB, Ipswich, USA) during 2 h at 60 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mU of phosphodiesterase II from Sigma (# P9041-10 UN) and 2 U of alkaline phosphatase from Biolabs (# M0290) were added and the mixture was incubated at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... and 2 μl of 1.5 μM NEBNext adaptors for Illumina sequencing (NEB): 5’-phos-GATCGGAAGAGCAC-ACGTCTGAACTCCAGTC/ideoxyU/ACACTCTTTCCTACACGACGCTCTTCCGATC*T-3’ and 5’-phos-GATCGGAAGAGCACACGTCTGAACTCCAGTC/ideoxyU/AC-ACTCTTTCCTACACGACGCTCTTCCGATC*C-3’ (* ...
-
bioRxiv - Cell Biology 2022Quote: ... Afterwards 2 µg of recombinant human Histone H3.1 (New England BioLabs, M2503), 100 µM S-(5′-adenosyl)-L-methionine chloride dihydrochloride (SAM ...
-
bioRxiv - Bioengineering 2022Quote: ... 0.25 μL of Phusion Hot Start DNA polymerase (2 unit/μL; NEB), 5 μL of 5x Phusion buffer (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by 2 μL of 20 mg/mL RNaseA (New England BioLabs) for 30 min at 37 °C ...
-
bioRxiv - Genomics 2020Quote: ... Agarose was subsequently degraded by adding 2 μl of β-agarase (Biolabs). To stretch DNA fibers ...
-
bioRxiv - Pathology 2019Quote: ... 1 μL (2 units) DNAse I (M0303S, New England BioLabs, Ipswich, MA), and 89 μL nuclease-free H2O ...
-
bioRxiv - Genomics 2019Quote: ... For that the mix containing 2 µL of RNAse H (NEB, #M0297S), 1 µL of E ...
-
bioRxiv - Biochemistry 2019Quote: ... 400ng of library was amplified for 2 rounds using standard Phusion (NEB) PCR conditions ...
-
bioRxiv - Developmental Biology 2020Quote: ... digested vectors by a 1:2 mixture of T4 ligase (NEB, M0202L) and T4 polynucleotide kinase (NEB ...
-
bioRxiv - Biochemistry 2019Quote: ... The protein was then passed over a 2 mL amylose column (NEB) and washed with 3 CV of Flag Wash Buffer ...
-
bioRxiv - Genomics 2021Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) without prior 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Biophysics 2021Quote: ... Handle 2 was then digested with Lambda Exonuclease (M0262, New England BioLabs), which removes nucleotides from linearized double-stranded DNA in the 5′ to 3′ direction ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 µL of 10mM dNTPmix and 2 µL of Phusion polymerase (NEB). PCR products were purified using the QIAquick PCR purification column and eluted with 30 µL Qiagen Elution Buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... 186 bp DNA (0.4 mg/ mL) in 1x NEBuffer 2 (NEB: B7002) was incubated with dATP (100 μM) ...
-
bioRxiv - Biochemistry 2020Quote: ... was de-phosphorylated with 2 μL of Calf Intestinal Phosphatase (NEB M0290S) for 1 hour with shaking (1250 rpm ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μM of 7MeGpppA or GpppA RNA cap analogue (New England Biolabs), 10 μM adenosyl-methionine (AdoMet ...
-
bioRxiv - Microbiology 2019Quote: ... (2) DSBs blunting with NEB’s Quick Blunting Kit (NEB, cat. number: E1201); (3 ...
-
bioRxiv - Biochemistry 2020Quote: ... PCR amplifications were carried out using 2 x Q5 Master Mix (NEB), with cycling times and temperatures according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... and further passivated with 2 mg/ml Bovine serum albumin (BSA, NEB:B9000S) to prevent non-specific binding of proteins and DNA to the surface ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’ and 5’ adaptors were ligated by truncated ligase 2 (NEB) and ligase 1 (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) before 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Genetics 2022Quote: ... 2 μg of total RNA was treated with DNase (New England Biolabs) and for the RT-qPCR experiment ...
-
bioRxiv - Genomics 2022Quote: ... followed by reverse-crosslinking with 2 ug/uL proteinase K (NEB, P8102), 1% SDS ...
-
Recurrent but short-lived duplications of centromeric proteins in holocentric Caenorhabditis speciesbioRxiv - Evolutionary Biology 2022Quote: ... RNA was treated with DNase I (New England Biolabs, 2 units/μl) at 37°C for 60 minutes followed by heat inactivation at 75°C for 10 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... beads were resuspended in 50 μL of 1X NEBuffer 2 (NEB, B7002S) containing 0.1 mM dATP and 15 units of Klenow Fragment (3’→5’ exo- ...
-
bioRxiv - Microbiology 2021Quote: ... 7 μl PEG8000 and 1 μl T4 RNA ligase 2 K227Q (NEB) at 25 °C for 1 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... We loaded genomic digests and 100ng of 2-log ladder (NEB N3200) onto a 1% agarose gel and subjected it to electrophoresis in 1XTTE overnight at 49V ...
-
bioRxiv - Immunology 2022Quote: ... a quantitative PCR reaction (10 µl 2 x PCR master mix (NEB), 1 x SYBR green (Thermo Fisher) ...
-
bioRxiv - Bioengineering 2022Quote: ... followed by 2 μL of 20 mg/mL RNaseA (New England BioLabs) for 30 min at 37°C ...