Labshake search
Citations for New England Biolabs :
1201 - 1250 of 1428 citations for 3 3 Dimethyl 6 oxa 3 phosphoniabicyclo 3.1.0 hexane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: Living ovaries were incubated at room temperature in SNAP solution containing 3 μM SNAP- Cell TMR-Star or SNAP-Cell 647SiR (New England BioLabs, S9105S and S9102S), 10% FCS and 0,2 mg/ml Insulin in Schneider’s medium ...
-
bioRxiv - Microbiology 2021Quote: ... The digested DNA (4 ml in total) was split into 4 aliquots and diluted in 8 ml ligation buffer (1X ligation buffer NEB 3 (without ATP), 1 mM ATP ...
-
bioRxiv - Zoology 2021Quote: ... a total of nine RNA libraries were prepared with 3 μg RNA using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Plant Biology 2021Quote: ... Detection of editing in the EBE region of CsLOB1 promoter was performed by amplifying the target region (primers in Supplementary Table 3) with high fidelity DNA polymerase Q5 (New England Biolabs, Ipswich, MA, USA), followed by cloning of PCR products and sequencing.
-
bioRxiv - Microbiology 2022Quote: ... We then used 1:3 insert to vector ratio in a 1 hour Hifi assembly reaction using NEBuilder HiFi DNA Assembly kit (NEB, Cat. No. E2621). After the HiFi assembly ...
-
bioRxiv - Physiology 2024Quote: ... and PCR was performed with Flag F (caaggacgacgatgacaaagtc) + 3’OUTR (CAGAGCCAACAACGTGAGGT) primers using Q5® High-Fidelity DNA Polymerase (New England Biolabs, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... hereafter called Flag-SERCA2-C) were constructed from 3×Flag-SERCA2 using a Q5 Site-Directed Mutagenesis Kit (New England BioLabs, Ipswich, MA, USA). mCherry-Sec61B (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... 3 ug RNA was treated with Promega RQ1 DNase (M6101) then cleaned up with the Monarch® RNA Cleanup Kit (NEB Biolabs, T2050S) and eluted in 30 µl dH2O.
-
bioRxiv - Molecular Biology 2023Quote: ... digoxigenin-11-ddUTP was added to the 3’ end of the digested fragments using terminal transferase enzyme (New England Biolabs, Ipswich, MA, USA).
-
bioRxiv - Microbiology 2023Quote: ... The upstream and downstream PCR products were designed to have an overlapping region of sequence to promote 3-part Gibson assembly (NEB Gibson assembly kit) and primers 5b and 4 had extensions to anneal to vector pMP62 ...
-
bioRxiv - Genomics 2023Quote: ... This 17 µl of DNA solution was incubated with 3 µl digestion mixture containing 1 µl BciVI (New England Biolabs, cat. no. R0596S) and 2 µl CutSmart buffer (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: All PolD mutants (Supplementary table 3) were generated using pLB047 and a Q5 Site-Directed mutagenesis kit (E0554 New England Biolabs Inc., Ipswich MA) as described by the manufacturer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The inserted barcoding sequences were annealed using randomized overlapping single stranded oligonucleotides by adding 3 µl of each oligonucleotide (100 µM) to 500 µl 1x 2.1 NEB-buffer (New England Biolabs, Ipswich, MA, USA, #B6002S) followed by boiling at 100 °C for 3 minutes to finally let them associate during the cooling to room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... GFP mRNA was produced in-house using the Hiscribe® T7 Quick high yield RNA synthesis kit and 3’-O-me-m7G cap analog (New England Biolabs, MA, USA) following the manufacture’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... each containing 50 ng of DNA (comprising both vector and insert at a 1:3 molar ratio) and high-concentration T4 DNA ligase (NEB Cat No. M0202T). The ligation mix was incubated at 16°C overnight and column-purified with molecular biology-grade water ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was synthesized from a DNA template (Supplementary Table 3) using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Ipswich, MA, USA) and treated with DNase I (NEB ...
-
Chromosome-level assembly of Cucumis sativus cv. ‘Tokiwa’ as a reference genome of Japanese cucumberbioRxiv - Genomics 2024Quote: ... we put 3 μg of the size-selected DNA for end-repair using NEBNext FFPE DNA Repair Mix (NEW INGLAND BioLabs inc., Massachusetts, USA) and NEBNext Ultra II End Repair/dA-Tailing Module ...
-
bioRxiv - Microbiology 2020Quote: ... PCR protocols entailed an initial phase of 95° C for 3 min using Hot Start Taq polymerase (New England BioLabs Inc., Ipswich, MA, USA), followed by 35 cycles at 50°C and 52°C annealing temperatures for 16S and ITS amplicons respectively ...
-
bioRxiv - Neuroscience 2020Quote: ... Sequencing libraries were generated from a total amount of 3 μg RNA per sample using NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... 500 μl of lysed cells were transferred to a tube containing 4.5 ml of digestion mix (1X NEB 3 buffer, 1% triton X-100) and 100 μl of the lysed cells were transferred to a tube containing 0.9 ml of digestion mix ...
-
bioRxiv - Plant Biology 2022Quote: ... 250 μL 2× lysis buffer (20 mM Tris-HCl, 40 mM Na2EDTA, 1% (w/v) SDS) and 3 μL proteinase K (NEB: P8102S, 20 mg/mL) were added and incubated under agitation at 55°C for 2 h ...
-
bioRxiv - Microbiology 2024Quote: ... 5’-GCT GCG TTC TTC ATC GAT GC-3’) were chosen with barcodes for PCR amplification using Phusion® High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, MA, USA). The PCR products were then mixed at equal density ratios and purified with a Gel extraction kit (QIAGEN ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 100 ng of DNA was cleaved with PstI HF and MseI restrictases in CutSmart® buffer (New England Biolabs; 3 hours at 37°C). P1 and P2 barcoded adapters corresponding to the restriction site of the enzymes were ligated immediately afterwards with T4 ligase (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were resuspended in 50 mL buffer 3 (20mM KPi pH 7.4, 1.2M Sorbitol, 10 mM ribonucleoside vanadyl complex (NEB S1402S, pre-warmed at 65 °C), 0.08mg/ml Zymolyase-20T (Amsbio 326921) ...
-
bioRxiv - Genomics 2022Quote: ... and for the synthesis of the second strand of cDNA was used the Klenow fragment 3’-5’ exo (New England Biolabs Inc., Ipswich, MA, USA), following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... cells were washed once with PBS for 3 minutes and subjected to nuclear staining with Hoechst (New England BioLabs; 4082S; diluted 1:5000 in PBS) for 5 minutes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... cells were washed once with PBS for 3 minutes and subjected to nuclear staining with Hoechst (New England BioLabs; 4082S; diluted 1:5000 in PBS) for 5 minutes ...
-
bioRxiv - Genomics 2021Quote: ... The selected DNA fragments were end-repaired and 3’-adenylated with the NEBNext® Ultra™ II End Repair/dA-Tailing Module (New England Biolabs, Ipswich, MA, USA). The DNA was then purified with AMPure XP beads (Beckmann Coulter ...
-
bioRxiv - Biophysics 2023Quote: ... linker (listed in Supplemental Table S6) was ligated to the 3′ end using T4 RNA Ligase 2 truncated KQ (New England Biolabs #M0373, 400 units per sample) in T4 Ligase reaction buffer (New England Biolabs #B0216 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... BlpI-KPC-2_Rv (5’ GCT CAG CTT ACT GCC CGT TGA CGC CCA AT 3’) and the NEBuilder® HiFi DNA Assembly Cloning Kit (New England BioLabs®Inc, United Kingdom), following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... purified KRAS protein was mixed with GMP-PNP (molar ratio of 10:1 GMP-PNP:KRAS) and calf intestinal alkaline phosphatase (NEB cat# M0290, 3 units per mg of KRAS). The reaction mixture was incubated for 3 hours at room temperature and then purified by size-exclusion chromatography on a 10/300 Superdex 75 GL column (GE Healthcare ...
-
bioRxiv - Molecular Biology 2024Quote: ... 6 and 4 μL of 6× Gel Loading Dye (B7025S, New England Biolabs) and 1.5 and 1 μL of 2.5 mg/mL EtBr were added ...
-
bioRxiv - Microbiology 2021Quote: ... purple (6×) (New England Biolabs). Samples were loaded into a 4-15% precast polyacrylamide gel ...
-
bioRxiv - Molecular Biology 2020Quote: ... Random Primer 6 (NEB, #S1230S), RNasin Ribonuclease inhibitor (Promega ...
-
bioRxiv - Microbiology 2024Quote: ... 6 U DNase-I (NEB) and 3 µL RNase A (NEB ...
-
bioRxiv - Genomics 2024Quote: ... and random primer 6 (NEB). The NEBNext Ultra II Non Directional RNA Second Strand Synthesis Module was subsequently used to convert single-stranded cDNA to double-stranded cDNA ...
-
bioRxiv - Neuroscience 2024Quote: ... 6 μl of 10 mM MnCl and 6 μl (=2400 units) of Lambda phosphatase (#P0753, NEB). Dephosphorylation was carried out at 30°C for 30 minutes and stopped by addition of Roti Load buffer (#K929.1 ...
-
bioRxiv - Genomics 2024Quote: ... and Random Primer 6 (NEB, S1230S). The samples were finally purified using AMPure XP Beads (Beckman Coulter Life Sciences ...
-
bioRxiv - Cancer Biology 2021Quote: ... Digests with 6 x loading dye (NEB) were run on a 1 % agarose gel at 100 V for 1 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... with 6 μl CutSmart Buffer (NEB, B7204) in a total volume of 60 μl for 3 hours at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... and 6 U Bst3.0 DNA polymerase (NEB) in total 15 μl reaction volume ...
-
bioRxiv - Microbiology 2020Quote: ... 6 mM MgSO4 (NEB, final 8mM Mg2+), 1.4 mM each dNTP (Enzynomics) ...
-
A rapid, highly sensitive and open-access SARS-CoV-2 detection assay for laboratory and home testingbioRxiv - Molecular Biology 2021Quote: ... 6 mM MgSO4 (100 mM stock, NEB), 0.32 U/μl NEB Bst 2.0 polymerase ...
-
bioRxiv - Cancer Biology 2021Quote: ... Digest with 6 x loading dye (NEB) was run on a 1 % agarose gel at 100 V for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 6 U of Heparinase I (NEB) was added to the first strand cDNA synthesis mix ...
-
bioRxiv - Neuroscience 2021Quote: ... 6 μl BST LF polymerase (NEB M0275L), and 36 μl DEPC-treated H2O ...
-
bioRxiv - Plant Biology 2024Quote: ... 6 µg of the commercial EngenCas9 (NEB) with 2 µg of the freshly synthetized SgRNA1 obtained with the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB) ...
-
bioRxiv - Bioengineering 2024Quote: ... 6 mM Magnesium Sulfate (MgSO4 – NEB #B1003), 1.4 mM deoxynucleotide (dNTP ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by PNGase A (NEB; pH 6). The released N-glycans were purified using initially a cation exchange material (Dowex AG50 H+ form ...
-
bioRxiv - Biochemistry 2024Quote: ... mixed with 6× DNA loading dye (NEB), and separated by agarose gel electrophoresis as in the DNA cleavage assays ...