Labshake search
Citations for New England Biolabs :
1201 - 1250 of 6227 citations for 1 1' 3' 1'' Terphenyl 4 4'' dimethanamine 5' 4 aminomethyl phenyl 9CI since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... and nuclease-free water in a 5:10:1:34 ratio) supplemented with 0.8 U/µl Proteinase K (NEB P8107S) for 48-72 hours in a humidified 37 °C incubator.
-
bioRxiv - Physiology 2024Quote: ... the following reagents were added to each tube containing 1 cell in ∼5 μL: 2 μL M-MuLV Reverse Transcriptase Reaction Buffer (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 89 nt product was phosphorylated with T4 PNK and a final 20 nt RNA oligo with sequence GGCUUCGCAGUCCUUAGAAG (Chemgenes) was ligated to the 5’ end of the 89 mer using T4 RNA Ligase 1 (NEB). Finally ...
-
bioRxiv - Developmental Biology 2024Quote: ... the RNA was ligated to the 5’ adapter from IDT (ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised) using the T4 RNA Ligase 1 (NEB). Adapter-ligated RNA was reverse-transcribed using SuperScript II (Thermo Fisher ...
-
bioRxiv - Genomics 2024Quote: ... were then applied to the slide and the sample was digested using 5 µg/mL-1 endoproteinase Glu-C (New England Biolabs) at 40°C for 15 min ...
-
bioRxiv - Biochemistry 2024Quote: 5 uL of GFP conditioned medium or 1 ug of each purified antibodies was treated with PNGase-F (NEB, P0704L) or Endo-H (NEB ...
-
bioRxiv - Genomics 2024Quote: ... 1: 120) diluted in the hybridization buffer (10% deionized formamide, 2X SSC, 100mg tRNA, 5% dextran sulfate, 2mM VRC (NEB), 0,2mg/mL BSA) ...
-
bioRxiv - Systems Biology 2024Quote: ... Both the DNA libraries and the pBAD33 plasmid backbone were then gel-purified and used for a ligation reaction in 5:1 molar ratio using the T4 DNA ligase (NEB). After PCR-purification of the ligation ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Lachnospiraceae bacterium Cpf1 (LbCpf1) (200 nM) were independently preincubated with sgRNA (600 nM) in cleavage buffer [1× NEBuffer 3 (New England Biolabs, Ipswich, MA), 10 mM DTT ...
-
bioRxiv - Neuroscience 2021Quote: ... Enzyme restriction with DpnII was performed in 30 µl reaction mix (1 µl DpnII, 3 µl DpnII buffer, 10 µl purified DNA and 16 µl H2O; New England Biolabs, Ipswich, MA) and incubation at 37°C for 2h ...
-
bioRxiv - Genomics 2021Quote: ... nascent RNA samples were processed through the following steps: (i) 3′ adapter ligation with T4 RNA Ligase 1 (NEB, Ipswich, MA; M0204), (ii ...
-
bioRxiv - Cell Biology 2020Quote: ... primers 1 - 3) and then inserting the resulting PCR product into BamHI-digested pBMN-mCherry using Gibson assembly (New England Biolabs, Ipswich, MA). The resulting pBMN-ARHGAP36-mCherry vectors with XhoI and SacII restriction sites were subsequently used in all experiments described herein.
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.1% Tween) with 3% BSA and then incubating the strips in 1:2000 dilution of monoclonal anti-MPB-HRP antibody (NEB, Inc, USA) in a blocking buffer for 1 h at room temperature ...
-
bioRxiv - Biophysics 2021Quote: ... was annealed with primer P3 (100 bp long) at a 1:3 DNA to primer molar ratio and ligated using T4 DNA ligase (NEB, catalog #M0202S). Primer P3 had biotin modification at its 3’ end ...
-
bioRxiv - Genomics 2022Quote: ... RNA samples were then processed through the following steps: (i) 3′ adapter ligation with T4 RNA Ligase 1 (NEB, Ipswich, MA; M0204), (ii ...
-
bioRxiv - Immunology 2023Quote: ... using primers that overlapped with pLenti-EF1-Blast at the xho1 site on the 5’ end and overlapped with the 5’-end of the RNase L coding sequence on the 3’-end (Supplementary table 1) and NEBNext® High-Fidelity 2X PCR Master Mix (New England Biolabs: M0541S). RNase L coding sequence was amplified using a 3’-end primer that overlapped with pLenti-EF1-Blast at the xba1 site ...
-
bioRxiv - Cancer Biology 2023Quote: ... The purified shESR1 and SGEN DNA were digested with XhoI and EcoRI and subsequently ligated at a molar ratio of approximately 3:1 with 10X T4 DNA Ligase Buffer (New England BioLabs Inc. #B0202S) and T4 DNA Ligase (New England BioLabs Inc ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and then ligated by Goldengate assembly with an insert-to-vector ratio as 3:1 and the T4 ligase (New England Biolabs, Cat# M0202L), following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... annealed and phosphorylated sgRNA (1:10) and T4 Ligase reaction buffer (1:10, #B0202S, New England Biolabs) with 10 mM 10x Adenosine 5’-Triphosphate (#P0756S ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proximity ligation was done under the following conditions: 1 unit/µl RNA ligase 1 (New England Biolabs), 1x RNA ligase buffer ...
-
bioRxiv - Genomics 2022Quote: ... and the PCR products were analyzed in 1% agarose with 1 kb DNA Ladder (New England Biolabs). Primers used in this study are shown in Supplemental Table S1.
-
bioRxiv - Molecular Biology 2022Quote: ... 1 µg of each pFRT-TO-CLIP-UPF1 mutant vector was digested with 1 µL SpeI (NEB) and 1 µL HindIII-HF (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 µl of 1 mM BG-(PEG)12-biotin (New England Biolabs; PEG linker available on request) was added to 200 µl of axonemes ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 mM EDTA pH 8.0 (Roth) and 1:100 Proteinase K (New England Biolabs 20 mg/ml)) in a 2 ml Eppendorf tube for at least 24 hours at RT in the dark ...
-
bioRxiv - Microbiology 2023Quote: ... A 1 ml aliquot of each phage was treated with 1 µl DNase (New England Biolabs, USA) at 37 ⁰C for 40 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 µL SUPERase•In RNase Inhibitor and 1 µL T4 RNA Ligase 2 truncated KQ (NEB, M0373L) were added to the RNA-adapter mixture ...
-
bioRxiv - Molecular Biology 2024Quote: ... and assembled into RNP complexes following the manufacturer’s instructions with a Cas9:gRNA or Cas12a:crRNA ratio of 1:1 in NEBuffer 3.1 (NEB). 8µg of Cas9 or Cas12a complexed with equimolar ratios of gRNA/crRNA were transfected into Ulva unless stated otherwise.
-
bioRxiv - Genomics 2024Quote: ... cells were incubated for 1 hr at RT with 1 µl of Nt.CviPII-pGL (NEB, 0.5 units) in 800 µl binding buffer per well (20 mM potassium phosphate pH 7.0 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... qPCR reactions were performed on 1 µL cDNA (diluted 1:8 in water) with Q5 polymerase (NEB), SYBR Green (Thermo Fisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Microbiology 2021Quote: ... and a total of 20 μg were ligated with 50 pmol 3′adaptor Linker (5′-rAppCTGTAGGCACCATCAAT–NH2-3′; NEB) via a 16 h incubation at 16°C using 20 U T4 RNA ligase (Ambion) ...
-
bioRxiv - Genomics 2020Quote: ... and SalI (5’-GTCGAC-3’, New England Biolabs Inc., MA, CA#R3138S) restriction enzymes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and A-tailed using Klenow (3′-5′ exo-; New England Biolabs M0212L). Illumina-compatible adapters were subsequently ligated to DNA ends ...
-
bioRxiv - Genomics 2021Quote: ... and A-tailed using Klenow Fragment (3’→5’ exo-) (New England Biolabs) followed by the ligation of NEXTFLEX® Bisulfite-Seq adapters ...
-
bioRxiv - Molecular Biology 2020Quote: ... A mix of 5 μl 3’Ligation Reaction Buffer 2x (NEB-kit) and 1.5 μl of 3’Ligation Enzyme Mix (NEB-kit ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’ and 5’ adaptors were ligated by truncated ligase 2 (NEB) and ligase 1 (NEB ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and A-tailed using Klenow Fragment (3’→5’ exo-) (New England Biolabs) followed by the ligation of NEXTFLEX® Bisulfite-Seq Adapters ...
-
bioRxiv - Microbiology 2020Quote: ... which were then degraded by the 5′-3′ ssDNA exonuclease RecJ (NEB). After rRNA depletion using the Ribo-Zero Gold rRNA removal kit (Illumina) ...
-
bioRxiv - Genetics 2022Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligase 2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA fragment overhangs are filled with Klenow Fragment (3’-5’ exo-) (NEB) to leave an A-overhang ...
-
bioRxiv - Microbiology 2021Quote: ... Linker-2 (5′-GAGTCTGCGTGTGATTCGGGTTAGGTGTTGGGTTGGGCCA-3′) was ligated using T4 RNA Ligase1 (NEB). Reaction mixtures were resolved on a 10% TBE-Urea gel ...
-
bioRxiv - Molecular Biology 2021Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligase 2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligas’ 2 ...
-
bioRxiv - Systems Biology 2023Quote: ... The second strand was synthesized using Klenow Fragment (3’ → 5’ exo-) (NEB). The dsDNA library was digested with Mlul-HF and Pad restriction enzymes (NEB ...
-
bioRxiv - Genomics 2023Quote: ... 10 μL of Digestion-3 mix (5 U NotI-HF (NEB, R3189L) in 1X CutSmart buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligase 2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Digested DNA was treated with Klenow Fragment (3’→5’ exo-) (NEB, M0212) in a final volume of 250 µL of 1x NEBNext dA-tailing reaction buffer (NEB) ...