Labshake search
Citations for New England Biolabs :
1151 - 1200 of 10000+ citations for Pig Glucagon Like Peptide 2 GLP 2 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... the oligo pool for each library was amplified with NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L) and the following primers ...
-
bioRxiv - Genomics 2023Quote: ... Approximately 7,500 cells were diluted with 1.25 ml of a dilution buffer containing 0.4x NEBuffer 2 (NEB, B7002S), 2 mg/ml BSA (ThermoFisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... with the inserts at 2 fold molar excess followed by multiple transformations into NEB stable competent E.Coli (NEB) to ensure at least 20x coverage of colonies for every sgRNA ...
-
bioRxiv - Bioengineering 2023Quote: All qPCR reactions were set up using 7.5 µl of 2 x Luna Universal qPCR master mix (NEB), 0.375 pmol forward primer ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were then digested by adding 2μL LysC (500ng/μL, Pierce) for 2 hours then 6μL trypsin (100ng/μL New England Biolabs) overnight ...
-
bioRxiv - Cancer Biology 2023Quote: We then set up the digestion reaction (1.5 μg of pX459, 2 μL of 10X NEBuffer 2.1, 1 μL of BbsI (NEB), and added H2O to a final volume of 20 μL) ...
-
bioRxiv - Physiology 2023Quote: ... muGFP and homology arms were PCR-amplified using Q5 High-Fidelity 2× Master Mix (New England BioLabs, M0492L). Primers for PCR were designed using the NEBuilder Assembly Tool ...
-
bioRxiv - Cell Biology 2023Quote: ... beads were equilibrated in 1x PMP buffer (50 mM HEPES, 100 mM NaCl, 2 mM DTT, 0.01% Brij 35, pH 7.5; New England Biolabs). Kinase reactions were performed with 1 μL commercial CK1δ (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 mM NaCl, 2 mM EDTA, 1% NP40, 0.1%SDS, 0.5 mM DTT, 40 U RNase inhibitor [New England Biolabs, cat#M0314L] ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were expressed and purified from 2 to 4 liters of Escherichia coli NiCo21(DE3) (New England Biolabs) as previously described (24) ...
-
bioRxiv - Molecular Biology 2023Quote: ... To a 10 μL aliquot of the supernatant were then added 2 μL of loading dye (NEB, #B7021S) and 1 μL of 2% sodium N-dodecanoylsarcosinate ...
-
bioRxiv - Genomics 2023Quote: ... with the ligation of 3′-small RNA Tru-Seq adapter using the truncated T4 RNA Ligase 2 (NEB). 45-150 nt capped small RNAs were recovered on 15% Urea-TBE gel (Novex ...
-
bioRxiv - Cell Biology 2023Quote: ... one well of cells was sacrificed for direct lysis in 2% SDS blue loading buffer (New England Biolabs) and protein analysis of tau and β-III-tubulin (Sigma T-8660 ...
-
bioRxiv - Molecular Biology 2024Quote: A 2-fold excess of either m7G(5’)ppp(5’)G RNA Cap Structure Analog (New England Biolabs) or chemically synthesized cap4 hexa-nucleotide (see cap4 synthesis below ...
-
bioRxiv - Cell Biology 2024Quote: ... We performed the SNAP-tag labeling in vivo with 2 μM SNAP-Cell TMR-Star (New England Biolabs) and visualized histones incorporated into chromatin after a pre-extraction of soluble histones before fixation with 2% paraformaldehyde for 20’ as 32 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... extracted PCR product with 2 μl of NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... These two oligos were ligated with splint oligo1 at 37°C for 2 hours using T4 ligase (NEB; 1U/ml T4 DNA ligase and 13 T4 DNA ligation buffer) ...
-
bioRxiv - Biochemistry 2021Quote: Peptide-N-glycosidase F (PNGase F) (New England Biolabs Inc., Cat. P0704S) was used for complete removal of N-linked oligosaccharides ...
-
bioRxiv - Plant Biology 2020Quote: ... 1.5 μg of biotinylated histone peptides were incubated with streptavidin beads (NEB) in binding buffer (50 mM Tris-HCl 8.0 ...
-
bioRxiv - Cell Biology 2023Quote: ... separated via self-cleaving T2A peptide was generated via Gibson Assembly (NEB). This cassette including a 5’ chimeric intron and 3’ poly adenylation signal sequence replaces the sequence of Pax7 exon 1 immediately 3’ of the ATG start codon ...
-
bioRxiv - Immunology 2022Quote: ... a gBlock encoding the OTII TCR was ordered from IDT and ligated into BglII-digested pMSCV PIG using HiFi DNA assembly master mix (E2621S, New England Biolabs). pMSCV-PIG TCR-OTII was digested with BstXI and SalI and then ligated with a gBlock encoding the mammalian CD4 gene to make pMSCV-mCD4-PIG TCR-OTII ...
-
bioRxiv - Microbiology 2020Quote: ... purified and ligated for 2 h at room temperature using the Instant Sticky-end Ligase Master Mix (NEB, Australia) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: Cells from each fin sample obtained as described before were washed in 2 ml PBS supplemented with 0.1% bovine serum albumin (BSA) (NEB). Each sample was divided into two replicate tubes ...
-
bioRxiv - Microbiology 2020Quote: ... These gBlocks fragments and a NdeI-HindIII-digested pET21b backbone were assembled using a 2× Gibson master mix (NEB). Two and a half μL of each fragment at equimolar concentration was added to 5 μL 2× Gibson master mix (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM MgCl2, 10% Glycerol, 0.05% NP-40, 2 mM DTT, 10 mM Ribonucleoside-Vanadyl complex [New England Biolabs, MA USA] ...
-
bioRxiv - Molecular Biology 2021Quote: ... 500 ng total RNA in a volume of 9 μl was ligated to 1 μl custom adapter mix (18S:28S ratio 1:2) using 1.5 μl T4 DNA ligase (New England Biolabs) in NEB next Quick ligation buffer (3 μl ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and then a final extension at 72°C for 2 minutes using Q5 High-Fidelity Polymerase (New England BioLabs). We conducted a nested PCR to sequence exon 2 (204bp ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µl 10 x dNTPs with dUTP instead of dTTP (2 mM each) and 1 µl T4 polymerase (NEB) were added and the mixture was incubated at 37°C in a thermal cycler for 20 min ...
-
bioRxiv - Biophysics 2022Quote: ... both were mixed (∼5μM acceptor strand and ∼2 μM phosphorylated donor strand in a final volume of 19μl) in T4 RNA ligation buffer (New England BioLabs) supplemented with 1mM ATP (New England BioLabs) ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... and permeabilized for 5 min on ice in PBS containing 0.5%Triton X-100 and 2 mM Ribonucleoside Vanadyl complex (New England Biolabs). Coverslips were preserved in 70% EtOH at -20°C ...
-
bioRxiv - Genomics 2019Quote: ... and resuspended in 198 µL A-tailing solution (1× NEB buffer 2, 500 mM dATP, 1% Triton X-100). DNA ends were A-tailed by adding 1.5 µL Klenow (exo- ...
-
bioRxiv - Developmental Biology 2020Quote: ... oligonucleotides for the HAS-1 or HAS-2 sgRNA guide sequences were phosphorylated using T4 PNK (NEB, Ipswich, MA) for 30 min at 37°C ...
-
bioRxiv - Immunology 2019Quote: ... Single cells were flow-sorted into 96-well plates containing 2 µL of nuclease-free water with 0.2% Triton X-100 and 4 U murine RNase inhibitor (NEB), centrifuged ...
-
bioRxiv - Molecular Biology 2019Quote: ... SI) were incubated for 2 hours at RT in T4 ligase buffer with 400 U of T4 ligase (NEB) in a total volume of 100 µl ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and 1.5 mg of protein was cleaved in a 2 ml reaction with 240 Units of TEV protease (NEB) for two hours at 30 °C ...
-
bioRxiv - Genetics 2021Quote: ... 53.5 μl of cut 3C library was mixed with 6.5 μl NEBNext FFPE Repair Buffer and 2 μl NEBNext FFPE Repair Mix (New England Biolabs), followed by incubation at 20°C for 15 minutes and addition of 3 volumes of AMPure XP beads for purification.
-
bioRxiv - Plant Biology 2020Quote: ... A 3 μl aliquot of the purified DNA fragments was blunted in a 20 μl reaction containing 2 μl buffer 2.1 (New England Biolabs), 1 μl 2 mM dNTPs ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 5 µl of CutSmart buffer and 2 µl of EcoRI-HF® (New England Biolabs, catalog no. R3101) were added before incubation for 6 h at 37°C ...
-
bioRxiv - Bioengineering 2021Quote: ... and assembled with oncocin and true negative oligo inserts (Supplementary Table 2) with NEBuilder® HiFi DNA Assembly (NEB), and cloned in 5α E ...
-
bioRxiv - Bioengineering 2021Quote: The LAMP reagent mix in a total volume of 25 μL contained 12.5 μL of WarmStart or Colorimetric WarmStart 2 × Master Mix (New England BioLabs) or Bsm polymerase (Thermo Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... non integrated plasmids were cut by 2 h digestion at 37 °C with I-CeuI restriction enzyme (NEB, R0699S) in a total volume of 70 ul followed by 20 minutes heat inactivation at 65 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... The Pre-hybridization Buffer was replaced with 250 μl of Hybridization Buffer (2x SSC, 10% deionized formamide, 0.1% Tween-20, 2 mM vanadyl ribonucleoside complex (New England Biolabs), 100 μg/mL salmon sperm DNA (Invitrogen) ...
-
bioRxiv - Physiology 2021Quote: ... with 2 mL freshly prepared TST buffer (0.03% Tween 20 [Bio-Rad], 0.01% Molecular Grade BSA [New England Biolabs] ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 2 μl of the circularized product was then used for PCR amplification using Phusion High-Fidelity DNA Polymerase (NEB) for a maximum of 16 cycles ...
-
bioRxiv - Bioengineering 2021Quote: 2 μl of genomic DNA was used to amplify strain barcodes by PCR (Q5 NEB master mix, 22 cycles) using primers containing sequence-optimized spacers to maximize nucleotide diversity in Illumina sequencing ...
-
bioRxiv - Systems Biology 2020Quote: ... We discarded the supernatant and resuspended the pellet in 2 mL of 1x NEB buffer 3.1 (New England Biolabs).
-
bioRxiv - Microbiology 2021Quote: ... 40 μL purified supernatant were combined with 2,500 units recombinant glycerol-free PNGase F and Glycobuffer 2 (New England Biolabs) following the manufacturer’s protocol for non-denaturing digestion and incubated at 37°C for 5 hours ...
-
bioRxiv - Biophysics 2020Quote: ... and loaded denatured (70 °C, 10 minutes) samples alongside an RNA ladder (2-4 μL, ssRNA ladder, N0362S, NEB). The resulting gels were stained with ethidium bromide for 30 minutes (0.5 μg/mL ddH20 ...