Labshake search
Citations for New England Biolabs :
1151 - 1200 of 1285 citations for Arsenazo I Trisodium Salt since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... single-stranded adaptors (5’-Phos – ATCCACAACAACTCTCCTCCTC – 3’) were linked to the AdSDV genome segments using T4 RNA ligase I (New England Biolabs). Using the reverse adaptor primer paired with another primer ...
-
bioRxiv - Microbiology 2022Quote: ... The isolated DNA was blunt-ended utilizing T4 DNA polymerase and Large Klenow fragment of DNA polymerase I (New England Biolabs) in the presence of 33 μM of each dNTP and cloned into the EcoRV restriction site of a pBluescript KS+ vector and sequenced by primer walking ...
-
bioRxiv - Plant Biology 2020Quote: ... the chain of multiplex tRNA-gRNA with three NsWOX9-spacers was inserted into an optimized vector with AtU6-tRNA-gRNAs-AtUbi10-Cas9-pRGEB31-bar backbone by digestion and ligation using Fok I (NEB) and BsaI enzymes (Xie ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Total RNA was extracted from cells grown to OD600 0.4–0.6 in 6 mL of SD[MSG] -ura -his using standard hot-phenol procedure (Köhrer and Domdey 1991) and RNA samples were treated with DNase I (New England BioLabs, USA) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Purified DNA from the ChiP procedure (25 μL) was digested with 1 μL of I-SceI endonuclease (#R0694S, New England Biolabs) for 1 h and heat inactivated ...
-
bioRxiv - Bioengineering 2021Quote: ... which were subsequently cloned into a custom vector (Supplementary sequence 2, BfuAI and EcoR I digested) by the Gibson assembly method (NEB). To generate nicking sgRNA expression plasmids ...
-
bioRxiv - Biophysics 2021Quote: ... Two experiments were conducted in which the vacuum filling of the channels with buffer was followed by a heating/diffusion step of 1 hour at 40°C with the reservoir filled with a solution containing both DNase I (at 0.096U/μl) and BSA (NEB B9000S) at 0.13mg/ml or 0.40mg/ml ...
-
bioRxiv - Synthetic Biology 2020Quote: ... U.S.A.).These respectively were used to clone the genes into storage plasmids (level I) by Golden Gate assembly with BsmBI and T7 DNA ligase (M0318L, NEB) for subsequent assembly into expression cassette-bearing plasmids (level II ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1 μg of DNase treated RNA was then taken for cDNA synthesis using the Protoscript I first strand cDNA synthesis kit (New England Biolabs). Selected genes were amplified by quantitative real time PCR (RT-qPCR ...
-
bioRxiv - Cell Biology 2021Quote: ... The β1 Integrin-HaloTag-GFP without ARL13B–C terminus (I-GFP) was generated by Q5 site directed mutagenesis (New England Biolabs).
-
bioRxiv - Cell Biology 2020Quote: ... F0 founders were identified by outcrossing TALEN or CRISPR/Cas9-injected fish with wildtype fish and screening the offspring for mutations at 2 dpf using T7 endonuclease I (NEB) assay (for TALEN-injected fish ...
-
bioRxiv - Microbiology 2021Quote: The DNA template for T7 transcription was prepared by linearizing the T7 replicon plasmid (#453, Supplemental Table I) with the restriction enzyme SacII (NEB), followed by protease K treatment ...
-
bioRxiv - Neuroscience 2020Quote: ... the enhanced green fluorescent protein sequence and an SV40 polyA) was blunted at both ends using a Klenow fragment of DNA polymerase I (NEB) and cloned into the EcoRV site of the pminiTol2 plasmid (ref) ...
-
bioRxiv - Genetics 2020Quote: ... three selected guide RNAs based on their high Guide Design Tool scores and low off-target probabilities were assessed by the T7 endonuclease I (NEB) assay per manufacturer’s direction ...
-
bioRxiv - Microbiology 2021Quote: ... 200 ng ΔVC1807::ErmR transforming DNA was added and reactions were incubated at 30 °C for 10 minutes before the addition of 10 units of DNAse I (NEB) to prevent additional DNA uptake ...
-
bioRxiv - Microbiology 2020Quote: ... The upstream and downstream fragments of four fnr genes were then fused with BamH I /HindIII digested vector pRN5101 in Gibson assembly master mix (New England Biolabs), generating the four recombinant plasmids ...
-
bioRxiv - Molecular Biology 2020Quote: ... the DNA editing efficiency of the sgRNAs at their specific targeting regions was determined in K562-Cas9-sgRNA cells by the T7 endonuclease I (NEB) assay (as described in the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... All these ssDNA-FQ reporters contained a fluorophore at their 5′ end and a matched non-fluorescent quencher at their 3′ end. The ssDNA-FQ reporters are listed in Supplementary Table S10. Exonuclease I (Cat. No. M0293S, New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were placed on ice and Ligation Master Mix (1x NEB Ligase Buffer, 1mM ATP, 25% PEG 8000, 15U T4 RNA Ligase I (NEB)) was added to samples ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR reactions were pooled and treated for 1 hour at 37°C with 250 u /ml of Exonuclease I (NEB). Libraries were purified using NucleoSpin Gel and PCR Clean-up (Macherey-Nagel) ...
-
bioRxiv - Cell Biology 2020Quote: ... pCS2-luciferase CDS or pCS2-luciferase with G3BP1 5’UTR and 3’UTR were linearized with Sal I (New England Biolabs) and gel purified (Qiagen) ...
-
bioRxiv - Plant Biology 2023Quote: ... the slides were mounted in a plastic cassette and sections incubated in pre-permeabilization solution21 (48 μl Exonuclease I buffer, NEB, cat no ...
-
bioRxiv - Immunology 2022Quote: ... and then chromatin was digested using intact nuclei and 200 U of the 4-base cutter Mbo I (New England Biolabs), and restricted ends religated as described Mumbach et al. ...
-
bioRxiv - Molecular Biology 2023Quote: A similar strategy was used to capture VirB-mediated changes in supercoiling using T4 DNA ligase with the following exceptions: i) purified PicsP-lacZ was nicked once using Nb.BsrD1 (NEB # R0648S) for 1 h at 65 °C and then purified using phenol/chloroform extraction and ethanol precipitation ...
-
bioRxiv - Genomics 2023Quote: ... 30 minutes at 72°C and finally held at 4°C until 1 μl Exonuclease I (20U/μl, catalog num. M0293S, NEB) was added to each sample ...
-
bioRxiv - Microbiology 2023Quote: ... The 5’ end ligated samples were purified using PCI extraction and then the 3’ App-PE adapters were ligated to the RPF using 40 U T4 RNA ligase I (NEB). The 5’ and 3’ ligated samples were resolved on a 12% TBE-Urea polyacrylamide gel and the band corresponding to the RPF was gel-excised ...
-
bioRxiv - Biophysics 2023Quote: ... and cloned into Sal I-digested GST vector pGEX-6P-1 (Cytiva) by NEBuilder HiFi DNA Assembly cloning (New England BioLabs). To express the GST fusion protein ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNAs reversely transcribed from carrier RNAs were removed from the RNA-seq library by Not I (NEB, USA, Catalog #R0189L) digestion after the adaptor ligation step ...
-
bioRxiv - Microbiology 2023Quote: ... The 32P-radioabelled RNase III.RNA complexes were washed and unique barcoded 5’ linkers and 3’ App-PE adapters were ligated to the bounded RNA using 40 U T4 RNA ligase I (NEB) for each ligation step ...
-
bioRxiv - Biophysics 2023Quote: ... was filled in with a mixture of natural and biotinylated nucleotides by the exonuclease-deficient DNA polymerase I Klenow fragment (New England BioLabs). The reaction was performed by incubating 17 μg λ DNA ...
-
bioRxiv - Immunology 2023Quote: ... Unincorporated primers were digested from the pre-amplified samples using 16 U/μl Exonuclease I (E. coli, New England Biolabs) at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... zebrafish were genotyped by PCR amplification of the shank3b gene with subsequent digestion with T7 endonuclease I (M0302; New England BioLabs). Genotypes were verified on a 2% agarose gel ...
-
bioRxiv - Microbiology 2022Quote: ... (5’-Phos-GAUCGUCGGACUGUAGAACUCUGAAC-3’-InvdT) was ligated to the 3’ end of the RNA using T4 RNA ligase I (NEB). RNA was purified as above by binding to streptavidin beads ...
-
bioRxiv - Microbiology 2022Quote: ... The 5’-RNA adapter (5’-CCUUGGCACCCGAGAAUUCCA-3’) was ligated to the 5’ end of the RNA using T4 RNA ligase I (NEB). RNA was purified as above by binding to streptavidin beads ...
-
bioRxiv - Cell Biology 2024Quote: ... each lysed by incubation in 1000 μL RIPA buffer + 2 mM PMSF + 60 μL PIC + 112.5 Kunitz Unit/mL DNase I (RNase-free, NEB M0303) + 2.5 mM MgCl2 (Sigma 5985-OP ...
-
bioRxiv - Systems Biology 2024Quote: ... We digested ∼2ug of each of 24 barcoded ORF plasmid pools (2 replicate pools of each of 9 hORFs and 3 vORFs) overnight with I-SceI (NEB) according to manufacturer’s recommendations ...
-
bioRxiv - Genomics 2024Quote: ... dATP (3x 1.5 µL of 10 mM solutions) and 8 µL of 5 U/µl Klenow fragment of DNA polymerase I (New England Biolabs) and a 30-minute incubation at 37°C with rotation ...
-
bioRxiv - Genetics 2024Quote: ... Genome PCR products which were confirmed as a single band in AGE were subjected to direct Sanger sequencing after decomposing remaining nucleotides and primers by the treatment with 2U Exonuclease I (NEB) and 0.1U Shrimp Alkaline Phosphatase (NEB).
-
bioRxiv - Biophysics 2023Quote: ... After 4 hours of incubation (required for transcription) RNA was directly treated with 4 units of DNase I (NEB, M0303S) to remove linear or circular DNA used as a template for transcription (see details in Supplementary Methods) ...
-
bioRxiv - Neuroscience 2023Quote: ... The guide RNA target site was amplified from transfected cells and PCR products were analyzed by T7 Endonuclease I digestion (New England Biolabs) or Sanger sequencing followed by ICE analysis (Synthego ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were treated with DNase I (20 units) in the presence of RNase inhibitor at 300 U/ml in x1 buffer # 2 (NEB) at 37°C for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... To avoid contamination of nascent RNA still attached to mtDNA into the higher molecular weight sucrose gradient fractions we digested all DNA by 150 units of DNAse I (NEB) in the presence of superaseIn (ThermoFisher ...
-
bioRxiv - Cancer Biology 2023Quote: Fresh omentum and omental HGSOC tumor metastasis biopsy samples were cut into small pieces and dissociated in digestion solution (1 mg/mL collagenase/Dispase [Sigma cat. no. 10269638001], 1 unit/mL DNase I [NEB, cat ...
-
bioRxiv - Cancer Biology 2024Quote: ... by PCR amplification with the indicated primers (Key Resources table) followed by a digestion with Bam HI and Xba I enzymes (New England Biolabs) for 37°C 2 h ...
-
bioRxiv - Microbiology 2023Quote: ... The fragments containing the transposon-junctions were amplified by PCR and prepared for sequencing using the NEB Ultra I kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... The IVT reaction product was treated with DNase I to remove the DNA template and then purified using the Monarch RNA clean-up kit (NEB). dgRNA concentration was measured using a NanoDrop.
-
bioRxiv - Bioengineering 2023Quote: ... The IVT reaction product was treated with DNase I to remove DNA template and then purified using the Monarch RNA clean-up kit (NEB). RNA concentration was measured using a NanoDrop (ThermoFisher).
-
bioRxiv - Microbiology 2023Quote: ... 2 µl of the Dpn I digested amplification product was transformed into 25 µl of NEB turbo competent E.coli (NEB, C2984). The desired mutation was initially confirmed by Sanger sequencing (Genomics Core Facility (UPF ...
-
bioRxiv - Pathology 2023Quote: Total RNA extracted from hearts of Ctrl and Eprs1cKO-homoat 2 weeks post tamoxifen injection were treated with DNase I (NEB) to remove potential genomic DNA in the RNA samples ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 μg of total RNAs from wild type LCL 25 and LCL MM were treated with DNAse I (M0303S-NEB), and reverse transcription was carried out with random hexamer primers (S0142-Thermo Scientific™ ...