Labshake search
Citations for New England Biolabs :
1151 - 1200 of 5659 citations for 7 Oxa 1 2 diazaspiro 4.4 non 1 en 6 one 4 methyl cis 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... 1 µL of 1 µM Cas9 Nuclease (diluted from 20 µM stock in 1X NEBuffer r3.1) (NEB; catalog # M0386T), and 1X NEBuffer 3.1 (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... while the ter region was amplified using the primer pair 3778_ter 1 qPCR fwd with 3778_ter 1 qPCR rev and the Luna Universal qPCR Master Mix (New England Biolabs). Quantification of the ori/ter ratio was performed using the the 2-ΔCT method as described [62].
-
bioRxiv - Molecular Biology 2023Quote: ... in a 10 μL reaction in buffer (50 mM Tris-HCl pH 7.5, 1 mM DTT, 1 U/μL RNase Inhibitor (NEB)) and incubated for 1 hour at 37°C ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR products were inserted into pET28a using restriction digestion and ligation with EcoR 1 and Sal 1 (NEB) sites.
-
bioRxiv - Microbiology 2023Quote: ... This digestion was performed on 1-3 µg of the PCR2 product with 1 µL of exonuclease (NEB #M0262) at 37°C for 30 min before heat inactivation ...
-
bioRxiv - Plant Biology 2023Quote: ... The precipitates were eluted into 30μL 1×SDS loading buffer and detected using anti-Myc and anti-MBP antibody (1:5,000, New England Biolabs).
-
bioRxiv - Genetics 2023Quote: ... 12% PEG-8000, 1 mM dNTPs, 1 μM second strand synthesis primer (AAGCAGTGGTATCAACGCAGAGTGAATG, Sangon) and 0.125 U/μL Klenow exo- (BioLabs)) at 37 °C for 1 h with rotation ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of GlycoBuffer 2 (NEB Cat # B0701S, 10X), 2 μL of 10% NP-40 (NEB Cat # B0701S ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 µl of NEBuffer 2 (New England Biolabs B7002) and 1 µl of Klenow large fragment DNA polymerase (New England Biolabs M0210 ...
-
bioRxiv - Genomics 2019Quote: ... and 4 U MmeI (NEB) for 2 h at 37 °C ...
-
bioRxiv - Genomics 2022Quote: ... 6.25x NEBuffer 4 (NEB, B7004S)) was added to each well ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 4 mM SAM (NEB). RNAs were then purified with the RNA Clean and Concentrator-5 Kit (Zymo) ...
-
bioRxiv - Genomics 2023Quote: ... 1.5 μL NEBuffer 4 (NEB), 0.75 μL T4 Phage β-glucosyltransferase (NEB M0357S) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mpe1 and one of the polymerase module genes were cloned into a SwaI (NEB) digested pBig1a vector of a modified biGBac system (Hill et al. ...
-
bioRxiv - Genomics 2019Quote: ... at room temperature for one hour and then transformed into NEB10 competent cells (NEB). Plasmids from independent colonies were isolated using a plasmid DNA minikit and Sanger sequenced to identify correctly inserted clones.
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed using the Luna Universal One-Step RT-qPCR Kit (NEB) in an Applied Biosystems QuantStudio 3 thermocycler ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was performed using the Luna Universal One-Step RT-qPCR Kit (NEB) in an Applied Biosystems QuantStudio 7 thermo-cycler ...
-
bioRxiv - Systems Biology 2022Quote: ... PCRs were performed using the Luna® Universal One Step RT-qPCR Kit (NEB) in a ThermoFisher Quantstudio 3 instrument ...
-
bioRxiv - Microbiology 2022Quote: ... One reaction of NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB #E7645) was used for 1 μg genomic DNA input ...
-
bioRxiv - Cell Biology 2019Quote: ... one was treated with 400U Lambda protein phosphatase (Lambda PP, New England Biolabs, #P0753S) in 50µl phosphatase assay buffer ...
-
bioRxiv - Plant Biology 2020Quote: ... One microgram of total RNA was then treated with DNase I (New England Biolabs) prior to the first-strand cDNA synthesis using AffinityScript RT-qPCR cDNA synthesis kit (Agilent Technologies) ...
-
bioRxiv - Genomics 2020Quote: ... and 1µl cDNA in 25µL reactions with One Taq DNA polymerase (New England Biolabs). Amplicons were examined under UV light on 1% agarose gels stained with ethidium bromide ...
-
bioRxiv - Genomics 2022Quote: ... samples were diluted one in two before adding 4,000 U T4 DNA ligase (NEB) for overnight incubation at 16°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... sgRNAs were cloned into an all-in-one CRISPR/Cas9 vector using BbsI (NEB). The all-in-one CRISPR/Cas9 vector was cloned between AAV serotype 2 ITRs including a human U6 promoter ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR was performed using Luna Universal One-Step RT-qPCR reagents (NEB, E3005) and the primers listed in Table S3.
-
bioRxiv - Genetics 2023Quote: ... Reactions were performed using the Luna Universal One-Step RT-qPCR Kit (NEB, E3005L) and a CFX Opus 384 Real-Time PCR System (Bio-Rad).
-
bioRxiv - Plant Biology 2023Quote: ... The Luna® Universal One-Step RT-qPCR Kit (New England Biolabs, Cat # E3005X) and reaction protocol (cycle variations ...
-
bioRxiv - Biochemistry 2023Quote: ... both the Luna Probe One-Step RT-qPCR 4X Mix with UDG (NEB M3019) and the Luna Universal Probe One-Step RT-qPCR Kit (NEB E3006 ...
-
bioRxiv - Genomics 2022Quote: ... RT-qPCR was performed with Luna Universal One-Step RT-qPCR Kit from NEB on BioRad CFX96 Touch Real-Time PCR Detection System ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1ng of RNA was added to Luna Universal One-Step qRT-PCR mix (NEB) containing 4μmol of each primer on ice ...
-
bioRxiv - Microbiology 2024Quote: ... the NEB OneTaq® One-Step RT-PCR Kit (New England Biolabs, Product # E5315S) was used to target the haemagglutinin gene ...
-
bioRxiv - Biochemistry 2019Quote: ... we used a commercial assay kit (Ph.D.-7 Phage Display Peptide Library Kit, New England Biolabs) and followed the recommended protocol for “solution phase panning with affinity bead capture” with the following modifications ...
-
bioRxiv - Genomics 2019Quote: ... 7 µL of eluate were treated with 0.5 µL exonuclease I (E. coli, New England Biolabs) in 1 x Herculase II reaction buffer (1 h ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgRNA.SFFV.RFP657 (sgRNA only for Cbl intron 7/8 targeting) using T4 DNA ligase (NEB, M0202S) (57) ...
-
bioRxiv - Genomics 2024Quote: ... and pooled into 7 ml ligation buffer (1X ligation buffer 3 (New England Biolabs; without ATP), 1 mM ATP ...
-
bioRxiv - Biochemistry 2022Quote: ... and immediately introduced into a second strand synthesis reaction using mRNA Non-Directional Second Strand Synthesis module (NEB). Double stranded DNA was then cleaned up using Ampure XP purification beads and eluted in 30 uL of nuclease-free water ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library preparation was performed with the NEBNext Ultra II Non-directional Synthesis Module (New England Biolabs, Ipswich, MA). Samples were sequenced on Illumina NextSeq High Output sequencer and aligned to combined genome from hg38 (human) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Non-overlapping forward and reverse primers containing the desired mutation were phosphorylated by polynucleotide kinase (New England Biolabs) as per the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... and the NEBNext Ultra II Non-Directional RNA Second Strand Synthesis Module (New England Biolabs, Ipswich, MA, USA). Subsequently ...
-
bioRxiv - Biophysics 2019Quote: ... Biotin- and digoxygenin-labeled handles were amplified with a non-proofreading Taq DNA polymerase (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Biophysics 2019Quote: ... Biotin- and digoxygenin-labeled handles were amplified with a non-proofreading Taq DNA polymerase (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Biochemistry 2023Quote: ... second strand synthesis was performed with the NEBNext Ultra II Non-Directional Second Strand Synthesis Module (NEB E6111S) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... non incorporated primers were removed using the Monarch PCR and DNA clean up kit (New England Biolabs, T1030), using a binding buffer ratio to DNA of 3:1 ...
-
bioRxiv - Cell Biology 2020Quote: ... Annealed handles were mixed with the purified 21 kb ARS1-DNA at a molar ratio of 15:1 and ligated with T4 DNA Ligase in 1 × T4 ligase buffer (both NEB) at 16 °C overnight ...
-
bioRxiv - Microbiology 2019Quote: ... 50 µg of BSM or 5% v/v washed erythrocytes in PBS were treated with 1:100 NA VLPs or 1:100 Arthrobacter ureafaciens NA (NeuA, New England BioLabs) for 4 hours at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... then overnight at 25°C with another 100 μl of the same buffer containing 2.7 μl END-seq adaptor 1 and 1 μl high concentration T4 DNA Ligase (NEB M0202M). After rinsing twice with 1 ml tris buffer ...
-
bioRxiv - Genomics 2020Quote: ... The crRNA and tracrRNA with Alt-R modification (Integrated DNA Technologies) were annealed in a 1:1 ratio to form gRNA that was used in the Cas9 (New England Biolabs) digestion of the SMRTbell libraries ...
-
bioRxiv - Genomics 2019Quote: ... the fragmented genomic DNA was ligated with 1 µL of 10 µM phosphorylated hairpin oligo mix (1 µL of NEB T4 ligase ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 μl of 1 mM BG-biotin or BG-(PEG)12-biotin (New England Biolabs; PEG linker available on request) was added to 200 μl of the purified axonemes in HMEEK buffer and incubated overnight at 4 °C ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR product was cloned into NdeI-SapI site of the expression vector pTXB-1 (Table 1, New England Biolabs) with a C-terminally tagged chitin binding domain (CBD ...