Labshake search
Citations for New England Biolabs :
1101 - 1150 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... Phusion High-Fidelity DNA polymerase (New England Biolabs; Cat. No. M0530) was used for PCR amplification of each construct ...
-
bioRxiv - Microbiology 2022Quote: ... We used two high fidelity PCR systems—Q5 (NEB cat. M0492), and Platinum SuperFi II (Invitrogen cat ...
-
A modular CRISPR screen identifies individual and combination pathways contributing to HIV-1 latencybioRxiv - Microbiology 2022Quote: ... Oligo pools were amplified using Phusion High-Fidelity DNA Polymerase (NEB) combined with 1 ng of pooled oligo template ...
-
bioRxiv - Immunology 2022Quote: ... All PCRs were performed using Q5 High Fidelity DNA Polymerase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... All PCRs were carried out using Q5 high fidelity polymerase (NEB). NEB Stable Competent E ...
-
bioRxiv - Genomics 2023Quote: ... we performed PCR with Q5 Hot Start High-Fidelity (NEB M0494S), column purification with QIAquick PCR Purification Kit (Qiagen 28104) ...
-
bioRxiv - Microbiology 2023Quote: ... amplified with Q5 High-Fidelity DNA Polymerase (NEB, Ipswich, MA, M0492S), and cloned into a bacterial artificial chromosome as described2 ...
-
bioRxiv - Microbiology 2023Quote: Routine PCR was performed using Q5 High-fidelity Mastermix (NEB M0492L). PCR purification and gel extraction was performed using Macherey-Nagel Kit cat ...
-
bioRxiv - Microbiology 2022Quote: ... DNA fragments were amplified using Phusion High Fidelity DNA polymerase (NEB) and the oligonucleotides listed in Table S3 ...
-
bioRxiv - Plant Biology 2023Quote: ... the Phusion high- fidelity DNA polymerase with proofreading (New England Biolabs) was used ...
-
bioRxiv - Molecular Biology 2023Quote: ... Amplification was carried out using high-Fidelity Q5 DNA Polymerase (NEB) for 16 thermal cycles ...
-
bioRxiv - Plant Biology 2023Quote: ... with Q5® High-Fidelity DNA Polymerase (New England Biolabs, USA) from the pTD2-MATE construct ...
-
bioRxiv - Developmental Biology 2023Quote: ... Samples were PCR-amplified (12.5 μL NEBNext High-Fidelity 2× NEB PCR Master Mix ...
-
bioRxiv - Molecular Biology 2023Quote: ... Amplicons were generated using Q5® High-Fidelity DNA Polymerase (NEB) using NORAD specific forward and reverse primers ...
-
bioRxiv - Genetics 2023Quote: ... All PCRs were performed using the high-fidelity Q5 polymerase (NEB) as per manufacture instructions ...
-
bioRxiv - Molecular Biology 2023Quote: All restriction enzymes were purchased from NEB and PCR amplification was performed with Q5 High-Fidelity PCR (NEB) following the manufacturer’s recommendations ...
-
bioRxiv - Plant Biology 2023Quote: ... followed by PCR using Q5® high-fidelity DNA polymerase (NEB) with specific primers (Table S2) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and/or Q5 High-Fidelity 2X Master Mix (New England Biolabs).
-
bioRxiv - Molecular Biology 2023Quote: ... All PCRs were performed using Q5 High-Fidelity DNA polymerase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... All PCRs were performed using Q5 High-Fidelity Master Mix (NEB). All Gibson assemblies were performed using NEBuilder HiFi DNA Assembly (NEB).
-
bioRxiv - Genomics 2023Quote: ... using touchdown PCR with Phusion High-Fidelity Polymerase (NEB, no. M0530S) and primers containing partial sequencing adapters (Supplementary Table 6) ...
-
bioRxiv - Biochemistry 2023Quote: ... by PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs, Ipswich ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCRs were carried out using High-Fidelity Q5 DNA Polymerase (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... as template and Q5 High-Fidelity DNA Polymerase (NEB, Cat. # M0515). AGO2 CDS was subsequently cloned into the pCI-neo-λN-v5 plasmid using the EcoRI and NotI sites ...
-
bioRxiv - Genomics 2023Quote: ... 25μL Q5 High Fidelity 2x master mix (New England BioLabs, M0492) in a final volume of 50μL ...
-
bioRxiv - Genetics 2023Quote: ... which was PCR amplified with Q5 High-Fidelity DNA Polymerase (NEB) using primers that contained 50-nt homology arms to knockout gene locus ...
-
bioRxiv - Plant Biology 2023Quote: ... using Q5® High-Fidelity 2X Master Mix (New England Biolabs). The two fragments were annealed and extended by overlapping PCR ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR was performed using Q5 High Fidelity 2X Master Mix (NEB) with primers purchased from Integrated DNA Technologies (IDT ...
-
bioRxiv - Cancer Biology 2023Quote: ... 25 µl 2x NEBNext high-fidelity 2x master mix (NEB # M0541), and 20 µl transposed/cleaned-up DNA sample ...
-
bioRxiv - Immunology 2023Quote: ... and amplified with NEBNext High Fidelity PCR Mix (New England Biolabs). Library quality was assessed using a TapeStation instrument ...
-
bioRxiv - Neuroscience 2023Quote: ... 25µL NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs), and 5µL of Nextera i5 and i7 indexed amplification primers (Illumina) ...
-
bioRxiv - Genomics 2023Quote: ... 50 µL NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S), 2.5 µL STAG_P701_NEX (10 uM) ...
-
bioRxiv - Genomics 2023Quote: ... 50 µL NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S), 2.5 µL 10 μM STAG_iP7_a1 oligo (5’-CAAGCAGAAGACGGCATACGAGATATTTACCGCAGTGACTGGAGTTCAGACGT*G*T-3’) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 120 U of restriction enzyme (PvuII high fidelity, New England Biolabs) were used to digest 6 μg of the purified genomic DNA for 5 h at 37C ...
-
bioRxiv - Genetics 2023Quote: ... All PCRs were performed using Q5 High-Fidelity DNA Polymerase (NEB). The identity of all plasmids was confirmed by Sanger Sequencing ...
-
bioRxiv - Neuroscience 2023Quote: Q5® Hot Start High-Fidelity 2X Master Mix (M0494S, NEB): 12.5 µL ...
-
bioRxiv - Genomics 2023Quote: ... We used Q5 High-Fidelity 2X Master Mix (New England Biolabs) for PCR ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR products were amplified using Phusion High Fidelity DNA Polymerase (NEB) and pRS300 plasmid containing the miR319a precursor served as the template 89,90 ...
-
bioRxiv - Molecular Biology 2023Quote: ... usingn Phusion® High-Fidelity PCR Master Mix (New England Biolabs). The target PCR products were mixed with the same volume of 1 × loading buffer (contained SYBR green) ...
-
bioRxiv - Biophysics 2023Quote: We use the high-fidelity restriction endonuclease HaeIII (New England BioLabs) to introduce topological activity into the DNA solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... 25 µL 2X Q5 high fidelity Mastermix (New England Biolabs, M0492S), 0.5 µM forward primer (LC1020) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μl Hot Start High-Fidelity 2× Master Mix (M0494S; NEB) and nuclease-free water to fill up to 10 μl ...
-
A modular circuit architecture coordinates the diversification of courtship strategies in DrosophilabioRxiv - Neuroscience 2023Quote: ... were PCR amplified using Phusion High-Fidelity PCR Master Mix (NEB) and cloned into pCFD4 (Addgene 49411 ...
-
bioRxiv - Microbiology 2023Quote: ... 50 µL of Q5® High-Fidelity 2X Master Mix (NEB), 5 µL each of 10 µM primer P1 and P2 (ACACTCTTTCCCTACACGACGCTCTTCCGATCTAAGGGCA GGCTGGGAAAT) ...
-
bioRxiv - Microbiology 2023Quote: ... PCR amplification was with high-fidelity Phusion polymerase (New England Biolabs). Constructs were verified by colony-PCR using Taq polymerase followed by DNA sequencing (performed by Eurofins-GATC Biotech).
-
bioRxiv - Evolutionary Biology 2023Quote: ... we used a high-fidelity Q5 polymerase (NEB, USA product #M0491). For each polymerase chain reaction (PCR) ...
-
bioRxiv - Cell Biology 2023Quote: ... gBlocks were PCR-amplified with Q5 High-Fidelity DNA Polymerase (NEB) using the forward primer T7-Kozak-start-fwd and the reverse primers HA-PolyA-rev (for PNPLA3-HA constructs ...
-
bioRxiv - Bioengineering 2023Quote: ... PCRs were performed with Q5 ® High-Fidelity DNA polymerase (NEB). PCR products were confirmed on a 0.8% agarose gel and purified using Wizard® SV Gel and PCR Clean-Up kit (Promega) ...
-
bioRxiv - Cell Biology 2023Quote: Phusion High Fidelity Master Mix with GC buffer (New England Biolabs) was used for site-directed mutagenesis of pDyn1 ...
-
bioRxiv - Neuroscience 2023Quote: ... or Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs).