Labshake search
Citations for New England Biolabs :
1101 - 1150 of 9222 citations for Glutathione Colorimetric Detection Kit 4 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... and purified using the Monarch RNA Cleanup Kit (NEB) and stored at −80 °C before use ...
-
bioRxiv - Molecular Biology 2023Quote: ... a site-directed mutagenesis kit (New England Biolabs Q5) was used ...
-
bioRxiv - Developmental Biology 2024Quote: ... Reactions were purified with a PCR purification kit (NEB). Approximately 120–150 ng of DNA was used as a template for a T7 in vitro transcription (IVT ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... were prepared using the NEBNext Ultra II DNA Prep Kit following the published protocol for this kit (New England Biolabs, Ipswitch, MA, USA), and quantified using an Agilent Bioanalyzer 2100 DNA 1000 kit (Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... we isolated DNA from tissue using the Qiagen DNeasy Blood and Tissue kit (Valencia, CA, USA) and created genomic libraries using the NEBNext Ultra II kit (New England BioLabs; Ipswich, MA, USA), according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... to evaluate the performance of our library preparation protocol – TM3’seq – and compare it to the performance of a commercial kit commonly used to generate RNA-seq libraries – NEBNext® Ultra™ Directional RNA kit (NEB, #E7420S). Three replicates of 200ng total RNA per tissue (blood and adipocyte ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Cloning was carried out using the Gibson Assembly® Master Mix kit and NEBuilder® HiFi DNA Assembly kit (New England Biolabs, US). Genomic DNA was prepared by the Blood & Cell Culture DNA Kit (QIAGEN ...
-
bioRxiv - Genomics 2020Quote: ... The first step involved incubation of total DNA with proteinA-MBD2-Fc mixture (NEBNext Microbiome DNA Enrichment Kit, New England BioLabs, Microbial enrichment kit, New England Biolabs, Cat No. E2612L), which binds and depletes methylated nuclear DNA fragments ...
-
bioRxiv - Microbiology 2021Quote: ... gDNA harvested with the Masterpure Complete DNA/RNA Purification Kit was bisulfite treated using the EpiMark Bisulfite Conversion kit (NEB; Ipswich, MA, USA); both per manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... rRNA was depleted from total RNA using Ribo-Zero™ rRNA removal Kit and library was made using Illumina NEBNext® Ultra™ Directional RNA Library Prep Kit (E7420L, NEB). The libraries were loaded on an Illumina HiSeq X ten instrument (Illumina) ...
-
bioRxiv - Genomics 2021Quote: ... gDNA was extracted from 1 ml of overnight culture with the kit Monarch HMW DNA Extraction kit (T#3060 New England Biolabs; Ipswich, MA, USA) following the manufacturer instructions for High Molecular Weight DNA extraction from gram-negative bacteria ...
-
bioRxiv - Plant Biology 2023Quote: Libraries for each sample were prepared using the NEBNext Ultra II DNA Library Prep Kit and NEBNext Muliplex Oligos for Illumina Kits (New England Biolabs, Ipswich, Massachusetts, USA) following the NEBNext Ultra II Version 5 protocol with size selection on DNA fragments at 300-400bp range ...
-
bioRxiv - Genomics 2023Quote: ... Two libraries were prepared for Nanopore MinION sequencing using the Ligation Sequencing kit (SQK-LSK108, ONT, Oxford, UK) and NEBnext DNA Repair kit reagents (NEB, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: The novel entry modules created for this study were cloned by insertion of PCR-amplified sequences in pJet1.3 or pMiniT 2.0 following manufacturer’s instructions (CloneJET PCR Cloning Kit, Thermo Scientific; NEB® PCR Cloning Kit, NEB). BsaI recognition sites followed by module-specific overhangs were added to each primer used to amplify entry sequences ...
-
bioRxiv - Genetics 2024Quote: ... The fragmented samples were purified with Expin™ PCR SV kit (GeneAll) and prepared as an NGS library with NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB). The prepared samples were sequenced with MiniSeq High Output Reagent Kit (300-cycles ...
-
bioRxiv - Biophysics 2021Quote: ... PfK5ΔL6-MD-SNAP was biotinylated or fluorescently labelled by overnight incubation at 4°C with SNAP-Biotin® or SNAP-Surface® Alex Fluor® 647 (New England BioLabs) with at least a 3:1 molar excess of these labels to PfK5ΔL6-MD-SNAP ...
-
Comprehensive profiling of antibody responses to the human anellome using programmable phage displaybioRxiv - Immunology 2022Quote: 5 μl ligation reactions were set up with a total of 500 ng DNA (vector and insert at a 1:4 molar ratio) and high-concentration T4 DNA ligase (NEB Cat No. M0202T). The ligation mix was packaged using the T7Select Packaging Extract (EMD Millipore ...
-
bioRxiv - Cancer Biology 2019Quote: ... sequences are listed in Supplementary Table 4) and cloned into pGL3-TK-5UTR-BsmBI-Luciferase using BsmBI (New England BioLabs; Whitby, Ontario, Canada). The “Snail 417” UTR insert was generated by PCR using the forward primer TATCGTCTCAACACCGAGCGACCCTGCATAAGCTTGGCGCTGAGCCGGTGGGCG and the reverse primer ATACGTCTCTCTTCCATAGTGGTCGAGGCACTGGGGTCG ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL ligation mix (2 µL 10x T4 ligase buffer, NEB, 1 µL T4 RNA ligase 2, truncated, NEB, 1 µL Ribolock inhibitor) was added and incubated (1 h ...
-
bioRxiv - Evolutionary Biology 2020Quote: Sequencing libraries were prepared using either the “NEBNext Ultra II DNA Library Prep Kit for Illumina®” (E7645) or the “NEBNext Ultra II FS DNA Library Prep Kit for Illumina®” (E7805) (New England BioLabs, Ipswich, USA). Sequencing was conducted on an Illumina MiSeq System (Illumina Inc. ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The described method follows the NEBNext® Ultra™ II DNA Library Prep Kit (v4.0) with Sample Purification Beads Kit (New England Biolabs, Ipswich, Massachusetts, USA). But other kits can be used too ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... or the NEBNext Ultra DNA Library Prep Kit for Illumina (formerly NEBNext DNA Library Prep Kit for Illumina; New England Biolabs Inc., Ipswich, Massachusetts, U.S.) and the NEBNext Multiplex Oligos for Illumina were used for library preparations ...
-
bioRxiv - Developmental Biology 2019Quote: ... An amount of 500 ng total RNA was used for RNA-seq library preparation with NEB NEBNext rRNA Depletion Kit and ENBNext Ultra Directional RNA Library Prep Kit (New England Biolabs Japan Inc., Tokyo, Japan); 2 × 36 base paired-end sequencing was performed with NextSeq500 (Illumina K.K. ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples with a RIN greater than 7 were processed for library preparation with NEBnext rRNA depletion kit and ULTRAII FS RNA-seq Library Preparation Kit for Illumina (New England Biolabs, Ipswich, MA, United States). This procedure involved steps for mRNA enrichment ...
-
bioRxiv - Microbiology 2020Quote: ... NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB), and NEBNext Multiplex Oligos for Illumina (NEB) ...
-
bioRxiv - Cell Biology 2020Quote: ... using the Q5 site-directed mutagenesis kit (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... the Q5® site-directed mutagenesis kit (New England Biolabs) was used on the Patgl-1::GFP plasmid previously generated (Noble et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... or BioLux® Cypridina Luciferase Assay Kit (New England Biolabs) and Gaussia luciferase was assayed from 1:40 diluted cell culture supernatant using either the Stop & Glo reagent from the DualLuciferase® Reporter Assay System (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... or BioLux® Gaussia Luciferase Assay Kit (New England Biolabs) in a Lumat LB 9507 luminometer (Berthold Technologies).
-
bioRxiv - Immunology 2021Quote: ... NEXTFLEX barcodes were ligated using the Quick Ligation Kit (NEB). Libraries were amplified for 15 cycles using HotStart HiFi Ready Mix (KAPA) ...
-
bioRxiv - Immunology 2021Quote: ... and NEBnext Ultra II RNA library prep kit (NEB E7770S). Briefly ...
-
bioRxiv - Genetics 2019Quote: ... mRNA was enriched using an NEBNext rRNA Depletion kit (NEB). Libraries for sequencing were prepped using an NEBNext Ultra II Library prep kit for Illumina (NEB ...
-
bioRxiv - Genetics 2021Quote: ... Capped mRNA was synthesized using the HiScribe SP6 kit (NEB) and purified using the RNA Clean & Concentrator kit (Zymo) ...
-
bioRxiv - Genetics 2021Quote: ... The NEBNext Library Quant Kit for Illumina (New England Biolabs) was used for the qPCR-based quantification of the pooled library ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and purified with the Monarch PCR & DNA Cleanup Kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... NEBNext Ultra II RNA Library Prep kit (New England Biolabs) was used to perform poly-A selection and prepare libraries for sequencing ...
-
bioRxiv - Immunology 2022Quote: ... and Luna® Universal RT-PCR Kit (New England Biolabs) in a StepOnePlus apparatus (Applied Biosystems ...
-
bioRxiv - Neuroscience 2021Quote: NEBuilder® HiFi DNA Assembly cloning kit (NEB, Cat# E5520S) was used to clone HexB gene promoters of various sizes and species into a promoterless AAV plasmid vector containing gaussia dura luciferase and GFP (LG ...
-
bioRxiv - Molecular Biology 2020Quote: Libraries were prepared using NEB Next kit (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... rRNA was depleted using the NEBNext rRNA Depletion kit (NEB). RNA-seq libraries were prepared using the NEBNext Ultra Directional RNA Library Prep kit (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid DNA was purified with mini-prep kits from NEB. Screening PCRs were performed using DreamTaq polymerase (Thermo Fisher) ...
-
bioRxiv - Bioengineering 2022Quote: ... The PURExpress® in-vitro synthesis kit (New England Biolabs) was used for in-vitro protein synthesis ...
-
bioRxiv - Genomics 2020Quote: ... RNA was purified using a Monarch RNA purification kit (NEB). RNA quality was evaluated with an Agilent Tape station ...
-
bioRxiv - Microbiology 2019Quote: ... NEB One Taq One-Step RT-PCR Kit (NEB # E5310S) was used for nucleic acid amplification ...
-
bioRxiv - Synthetic Biology 2019Quote: The PURExpress in vitro protein synthesis kit (New England BioLabs) was used to transcribe and translate Were-1-Fluc ...
-
bioRxiv - Genomics 2020Quote: ... using the NEBNext Ultra II DNA Library Prep Kit (NEB). ChIP samples were single-end (1 × 75 bp ...
-
bioRxiv - Developmental Biology 2019Quote: 2.3.4 The Q5 Site-Directed Mutagenesis Kit (NEB, Cat #: E0554S) can be used to make deletion and substitution mutations of DNA constructs.
-
bioRxiv - Developmental Biology 2019Quote: ... purified with the Monarch PCR and DNA Cleanup kit (NEB), and then dialyzed with 0.5X TE buffer using a 0.025 μm VSWP membrane (Millipore ...
-
bioRxiv - Immunology 2019Quote: ... purified using the Monarch Gel Extraction kit (New England Biolabs), and cleaned with MinElute PCR Purification Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... removing DNA overhangs with the Quick Blunting™ Kit (NEB), and circularization with T4 Ligase (Thermo Fisher Scientific ...