Labshake search
Citations for New England Biolabs :
1101 - 1150 of 7560 citations for 2' Chloro 4 5 5 dimethyl 1 3 dioxan 2 yl butyrophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2021Quote: ... P1 indexing barcodes were added using forward primers P1_inner_A through P1_inner_D and reverse primer P1_inner_nested_rev (Supplementary file 6) for 5 cycles at an annealing temperature of 55C followed by 5 cycles with no annealing step (NEB Q5). PE2 indexing barcodes were then added by amplifying 2 microliters of the previous reaction with forward primer P1_outer and reverse primers PE2_outer_SIC69 and PE2_outer_SIC70 (Supplementary file 6 ...
-
bioRxiv - Microbiology 2020Quote: ... was PCR amplified with forward primer (5’CGCGGATCCATGGATTTGTTTATGAGAATCTT3’) and reverse primer (5’ AAGGAAAAAAGCGGCCGCCAAAGGCACGCTAGTAGTC3’) by using Phusion High-Fidelity DNA Polymerase (New England Biolabs, M0530L) according to the manufacturer’s protocol and inserted into pcDNA5.1/FRT/TO vector (a kind gift from professor Torben Heick Jensen ...
-
bioRxiv - Genomics 2024Quote: ... We amplified target sequences by PCR using primers designed to span alternatively spliced junctions (FP-5’AGAACGGCAACTCCAATGGC3’ and RP-5’GCCAGTCTCCTTGTCAATGA3’) and Quick load Taq 2X Master mix (#M0271L, NEB, USA) according to the manufacturer’s protocol (28 cycles) ...
-
bioRxiv - Genomics 2024Quote: ... by including a tevopreQ1 motif,40 we first inserted a DNA duplex annealed from DNA oligos (5′-CGCGCCCGTCTCACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAATTTTTTTC, 5′-TCGAGAAAAAAATTCTAGTTGGTTTAACGCGTAACTAGATAGAACCGCGTGAGACGGG) into pJY127 digested with AscI (NEB R0558S) and XhoI ...
-
bioRxiv - Microbiology 2024Quote: ... The PS oligonucleotide (5’-CGCGGGCCTCTACAACCGGCACCGTG) was synthesized by IDT and 5’-labeled with [γ-32P]ATP and T4 polynucleotide kinase (NEB) to generate the [32P]PS probe ...
-
bioRxiv - Biophysics 2022Quote: ... A low-pressure chromatography column connected to a peristaltic pump (5 mL/min flow rate) was prepared with 5 mL amylose resin (NEB #E8021S), followed by equilibration with 50 mL Amylose A Buffer ...
-
bioRxiv - Microbiology 2023Quote: ... pUA_minusFP_R: 5’ggatccatcgaggtgaagacg) and circularizing the product with a bridging oligonucleotide (5’cgtcttcacctcgatggatccatgtccagacctgcaggcatg) using the NEBuilder® HiFi DNA Assembly (NEB) kit ...
-
bioRxiv - Biochemistry 2023Quote: ... The DNA bound to the beads was made ss by λ exonuclease digestion of the strand with 5’ phosphate (5 U/mg DNA, NEB). The reaction was carried out at 370 C for 1 h ...
-
bioRxiv - Microbiology 2024Quote: ... and dominant negative RabD2T91N (RabD2TN) primers (forward primer 5’TGTTGGTAAAAACTGTTGTATGAATAGATATGTTAG3’ reverse primer 5’GAAGACTCTCCTACCATAATAAC3’) using Q5 Site-directed mutagenesis kit (E0554S New England Biolabs, USA) as per manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: The beads were magnetically separated and 4 µl of hot PNK mix (0.2 µl PNK [New England Biolabs], 0.4 µl 32P-γ-ATP, 0.4 µl 10x PNK buffer [New England Biolabs], 3 µl H2O) was added and incubated for 5 min at 37°C in a thermomixer at 1,100 rpm ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.5 mg of pNL003 plasmid (38) was linearized by incubation at 37 °C for 2-4 h in the presence of EcoRV (NEB R0195S). Transcription reactions (10 mL ...
-
bioRxiv - Molecular Biology 2020Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 2 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml tris buffer (10 mM Tris HCl pH 8.0) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Standard Illumina adapters were ligated using 60 cycles of digestion at 37 °C (2 minutes) and ligation at 16 °C (4 minutes) with 400 U of T4 ligase (New England Biolabs, USA), followed by heat-inactivation at 65 °C (10 minutes) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 4 µg of each lysate in 2X Laemmli buffer containing DTT/BPB was combined with GlycoBuffer 2 (1X final; NEB, P0704S) and NP-40 (1% final ...
-
bioRxiv - Immunology 2021Quote: ... the samples were added to 2 μL of second-strand synthesis mix containing 2.25× NEB buffer 2 (NEB), 0.625mM each dNTP Mixture (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... The purified products were subjected to dA tailing with 2 μL of 10X NEBuffer 2 (New England BioLabs), 0.1 μL of 100 mM dATP ...
-
bioRxiv - Biochemistry 2024Quote: ... the reaction described above included another 2 µL of mRNA cap 2′-O-methyltransferase (50 U/µL, NEB). The capping reaction was incubated at 37°C for 4 h ...
-
bioRxiv - Neuroscience 2020Quote: ... + 5 % non-fat milk for 1 hour at room temperature before incubating with primary antibody: anti-GFP (1:1000, Biolabs) or anti-actin (1:5000 ...
-
bioRxiv - Microbiology 2023Quote: ... The membrane was washed three times in TBS-T for 5 min each before incubation for 1 h with secondary antibody (anti-rabbit IgG HRP, 1:5000 dilution, 7074S, NEB) in TBS-T with 1% (w/v ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 µl exonuclease T with 10 µl buffer 4 (NEB) was used in the enzymatic reaction ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein Phosphatase Inhibitor 2 (New England Biolabs) and Trichostatin A HDAC inhibitor (TSA ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 µl 10 mM ATP (NEB, 0756), 1 µl 100 mM DTT (Cell Signaling Technology Europe ...
-
bioRxiv - Cell Biology 2020Quote: ... in 1x glycobuffer 2 (New England Biolabs), and 10% NP-40 (New England Biolabs ...
-
bioRxiv - Genomics 2020Quote: ... and 2 μL T4 PNK (NEB, M0201L) were added to the sample in respective order ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 2 µl of 20 µM SpCas9 (NEB, Cat ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 3.13 μL BSA 2 mg/mL (NEB), 12.5 μL FastDigest NotI (ThermoFisher) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 3.13 μL BSA 2 mg/mL (NEB), 12.5 μL FastDigest NotI (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10ng of 2-log ladder (NEB N3200L) was loaded instead of 100ng ...
-
bioRxiv - Genomics 2020Quote: ... in 1X Buffer 2 (New England Biolabs) at 37°C for 1 hr ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl T4 ligase (New England Biolabs), 2 μl SrfI (New England Biolabs) ...
-
bioRxiv - Genomics 2021Quote: ... 25 µL 2× Q5 master mix (NEB); 1 µL 10 µM TruSeq PCR handle primer (IDT) ...
-
bioRxiv - Plant Biology 2020Quote: ... and 2 μl fragmentase (New England Biolabs) and brought up to 20 μl in nuclease free water and incubated at 37°C for 20 minutes before stopping with 5 μl of 0.5M EDTA ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 mM ribonucleoside vanadyl complex (NEB S1402S), 100 units/mL SUPERase In (Thermo Fisher AM2694) ...
-
bioRxiv - Bioengineering 2020Quote: ... 2 U/µlL murine RNase inhibitor (NEB), 1.5 U/µl NextGen T7 RNA polymerase (Lucigen) ...
-
bioRxiv - Neuroscience 2020Quote: ... and 2% BSA (B9000S, New England Biolabs) for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... 2 U of EcoRI (New England Biolabs) and one unit of T4 DNA Ligase in a total volume of 20 μL of 1X reaction buffer for one hour at 200 C ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2 µl PNGase F (NEB P0704S), 3µl 10% NP40 ...
-
bioRxiv - Biophysics 2022Quote: ... 2 mM ribonucleoside vanadyl complex (NEB, S1402S), 0.1% (v/v ...
-
bioRxiv - Genomics 2022Quote: ... 2 U/μl T4 DNA Ligase (NEB)
-
bioRxiv - Microbiology 2022Quote: ... 2 units of yeast Inorganic pyrophosphate (NEB) and T7 Polymerase for 4-6 hours ...
-
bioRxiv - Genomics 2020Quote: ... and 2 μl T4 PNK (NEB, #M0201L)) at 37°C for 15 min ...
-
bioRxiv - Genomics 2020Quote: ... then 2 × 104 U of MNase (NEB) was added and incubated for a further 5 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mg/ml BSA (New England Biolabs), 10 mM Tris-HCl pH 8 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Two concentrations of 2-log ladders (NEB) were included as reference for analysis ...
-
bioRxiv - Immunology 2021Quote: ... Step 2 was digested with EcoRI (NEB), blunted with Klenow (NEB ...
-
bioRxiv - Genomics 2022Quote: ... 10 μl of 2% BSA (NEB B9000S), 2 μl of 20 U/mL SUPERaseIn ...
-
bioRxiv - Synthetic Biology 2023Quote: ... rabbit anti-Sox-2 (New England Biolabs), and rabbit anti-NANOG (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 mM ribonucleoside vanadyl complex (NEB, S1402S), 100 units/mL SUPERaseIn (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 μl T4 PNK (NEB, #M0201L) to the dephosphorylated nuclei sample and incubate at 37°C for 15 min ...
-
bioRxiv - Genetics 2024Quote: ... 2 mM Vanadyl Ribonucleoside complex (NEB S142), 0.5% BSA (Ambion ...