Labshake search
Citations for New England Biolabs :
1051 - 1100 of 1175 citations for Recombinant Mouse EFNA4 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: In vitro translation was monitored by the production of luciferase signal in a PURExpress in vitro protein synthesis kit (NEB), using firefly luciferase mRNA as an input ...
-
bioRxiv - Developmental Biology 2024Quote: ... The Cas9-sgRNA ribonucleoprotein complex (RNP) solution was prepared as follows: Cas9 protein (EnGen® Spy Cas9 NLS, NEB, M0646T) 1.3μl ...
-
bioRxiv - Cell Biology 2024Quote: ... Reactions were quenched by addition of EDTA to 50 mM and proteins were removed by treatment with proteinase K (20 units/ml) (NEB) and SDS (0.25% ...
-
bioRxiv - Cell Biology 2024Quote: ... Digest were quenched by addition of EDTA to 25 mM and proteins were digested by incubation at 37°C for 40 min following addition of SDS and Proteinase K (NEB) to 0.25% and 20 units/ml respectively ...
-
bioRxiv - Biophysics 2024Quote: ... On-column phosphatase treatment was performed by incubating the resin with 10 mL SEC buffer supplemented with 1 mM MnCl2 and 4,000 units (10 μL) Lambda Protein Phosphatase (LPP) (New England BioLabs P0753L) standing at 4°C overnight ...
-
bioRxiv - Biophysics 2024Quote: ... In vitro pull-down binding assays were performed in triplicate by incubating proteins at their indicated concentrations with 20 µL amylose resin (bead bed volume; New England Biolabs) in a 200 µL reaction in Assay Buffer (20 mM HEPES pH 7.4 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Protein-coding or lncRNA genes with adjusted P-value < 0.05 and absolute log2 fold change > 1 (NEB Directional RNA-seq) or with adjusted P-value < 0.05 and absolute log2 fold change > 0 (QuantSeq 3’ mRNA-seq ...
-
bioRxiv - Cell Biology 2024Quote: ... Reactions were quenched by addition of EDTA to 50 mM and proteins were removed by treatment with proteinase K (20 units/ml) (NEB) and SDS (0.25% ...
-
bioRxiv - Molecular Biology 2024Quote: ... then 40 μL of each sample was used reactions as outlined in the manufacturer’s protocol for denaturing reaction conditions using the Protein Deglycosylation Mix II Kit (New England Biolabs, P6044) both with and without deglycosylase enzymes ...
-
bioRxiv - Molecular Biology 2024Quote: ... The pRL814 (containing green fluorescent protein (GFP) under control of PT7A1-O34) backbone was digested with NdeI and HindIII-HF (NEB). The digested backbone and amplified genes were ligated using NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Biochemistry 2024Quote: PamB2-ribosome complexes were generated by in vitro transcription-translation reactions in PURExpress in vitro protein synthesis system (New England Biolabs) with the same reaction mix as described earlier in the toeprinting assays ...
-
bioRxiv - Plant Biology 2024Quote: ... MBP-RVE4 and MBP-RVE8 proteins were expressed in Escherichia coli BL21 strain according to the manufacturer’s instructions using the pMAL Protein Fusion and Purification System (New England Biolabs; #E8200) and purified using MBPtrap HP column (Cytiva ...
-
bioRxiv - Synthetic Biology 2024Quote: ... where separately introduced to the wild-type MS2 coat protein present in these mRNA constructs using the NEB-Q5 mutagenesis kit (New England Biolabs). The primer sets and PCR settings used are listed in supplementary information ...
-
bioRxiv - Microbiology 2024Quote: ... SINV-REP construct derived from pToto64 clone encoding SINV non-structural proteins and a reporter luciferase tag was linearized using SacI (New England Biolabs), followed by in vitro transcription using SP6 RNA polymerase (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bound antibodies were detected by incubation with anti-rabbit or anti-mouse DyLight 800-conjugated secondary antibodies (New England BioLabs). Slide images were acquired using an InnoScan 710-IR scanner (Innopsys ...
-
bioRxiv - Immunology 2021Quote: ... A mouse SUV39H1 gBlock was synthesized (IDT) and cloned into AgeI/BSpEI-digested pL-SFFV-RFP using Gibson assembly (NEB) for 1hour at 50°C ...
-
bioRxiv - Cell Biology 2022Quote: The DNA sequence coding for full length of p21 and Cyclin B1 was amplified from mouse cDNA by PCR using Phusion high-fidelity DNA Polymerase (New England BioLabs) and cloned in frame into Ch plasmid with AsiSI and NotI restriction endonucleases (New England BioLabs) ...
-
bioRxiv - Genomics 2020Quote: ... The protocol started with tissue pre-permeabilization (30 min at 33°C for mouse brain) with addition of 120μl reagent per well of exonuclease I buffer (NEB, USA). In case spleen sections were processed ...
-
bioRxiv - Neuroscience 2019Quote: ... Secondary antibodies used were: Alexa-680 goat anti-mouse IgG and Alexa-800 goat anti-rabbit IgG (New England Biolabs). For DRGN cultures ...
-
bioRxiv - Molecular Biology 2019Quote: Libraries were prepared with NEBNEXT rRNA Depletion kit (human/mouse/rat) and NEBNEXT Ultra II Directional RNA Library Prep kit for Illumina (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: The CAG-HA-RBMS3-PCDH cDNA expression plasmid was cloned using a cDNA template made from RNA from the lungs of a wild-type mouse using the Q5 polymerase (NEB) and restriction endonuclease cloning with the following primers ...
-
bioRxiv - Neuroscience 2021Quote: ... One piece of mouse frontal cortex tissue (6-10 mg) was placed in 3 ml of ice-cold nuclei extraction buffer (NEB) [0.32 M sucrose ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 μg of total RNA was depleted of rRNA using NEBNext rRNA Depletion Kit (Human/Mouse/Rat) prior to cDNA synthesis primed with random hexanucleotide oligonucleotides (Random Primer 6, NEB). Sequencing library construction was carried out using NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Cell Biology 2019Quote: ... Standard qualitative PCRs to check for the general abundance of distinct SPIRE1 splice variants were performed employing cDNAs from mouse brain tissue and Q5 High-Fidelity DNA polymerase (New England Biolabs). Expression vectors encoding mouse SPIRE1 ...
-
bioRxiv - Immunology 2020Quote: ... Single antigen specific memory B cells were sorted on BD FACS Aria II into 96-well PCR plates (Axygen) containing 10 μl per well of lysis buffer (10 mM DPBS, 4 U Mouse RNase Inhibitor, NEB). Plates were immediately frozen on dry ice and stored at 80 C or processed for cDNA synthesis.
-
bioRxiv - Immunology 2024Quote: N-linked glycans were enzymatically released from purified mouse THP using PNGase-F kit (catalog no P0709S, New England Biolabs). N-glycans were then purified from the reaction mixture containing denaturing buffer and de-N-glycosylated proteins by solid phase extraction method using Sep-Pak C18 (1 cc Vac-cartridges ...
-
bioRxiv - Microbiology 2024Quote: ... AnTat1.1 sequence was obtained from AnTat1.1 specific cDNA from mouse infection D6 cloned into a pMiniT vector with the PCR Cloning Kit (NEB, E1202S). VSG-228 was partially amplified from VSG PCR (see below ...
-
bioRxiv - Immunology 2023Quote: ... The custom sgRNA vector used in this study was a hybrid AAV-SB-CRISPR plasmid for targeting primary mouse NK cells (AAV-SB100x) that was constructed by gBlock fragments (IDT) followed by Gibson Assembly (NEB). The Surf-v2 library was cloned into the AAV-SB-CRISPR vector by pooled cloning to generate the AAV-SB-Surf-v2 plasmid library.
-
bioRxiv - Neuroscience 2023Quote: ... To generate these constructs gene block fragments that codify for those sequences were produced in the Duke Transgenic Mouse Facility and cloned into the backbone using EcoRI-HF Restriction Enzyme (NEB) and In-Fusion HD Cloning Kit (Takara ...
-
bioRxiv - Molecular Biology 2023Quote: ... The corresponding regions of a partial mouse Azin1 gene were amplified from mouse tail genomic DNA by using Phusion Hot Start Flex 2X Master Mix (New England Biolabs) and the following primers ...
-
bioRxiv - Cancer Biology 2022Quote: ... rRNA depletion was performed using a NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) and RNA was purified using Agencourt RNAClean XP Beads (New England Biolabs). Libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2019Quote: ... of pA-Dam protein was incubated with 500 ng of unmethylated plasmid in 20 µL of 1x dam MethylTransferase buffer (New England BioLabs #M0222S) supplemented with 80 µM S-adenosylmethionine (SAM ...
-
bioRxiv - Biochemistry 2020Quote: In vitro trans-translation assays were performed using the PURExpress In Vitro Protein Synthesis and Δ Ribosome kits (New England Biolabs). For trans-translation assays ...
-
bioRxiv - Genomics 2021Quote: ... Samples were then combined and AMII adapters containing the motor proteins needed for sequencing were ligated using NEBNext® Quick Ligation Module (NEB). AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Biochemistry 2020Quote: ... Beads were resuspended in 1 volume of buffer A / 300 mM NaCl / 2 mM MnCl2 / 1 mM DTT and incubated with λ protein phosphatase (NEB) at 50 U / mL for 1 hour at 23°C with agitation ...
-
bioRxiv - Biochemistry 2021Quote: ... The RNAs were recovered from the gel slices by digesting the protein with proteinase K (8 U; P8107S, NEB, Ipswich, MA) leaving a polypeptide remaining at the crosslinked nucleotide ...
-
bioRxiv - Plant Biology 2020Quote: 20-33 kD subregions of NRPD1 and RDR2 polypeptides were expressed in vitro using a PURExpress® In Vitro Protein Synthesis Kit (New England Biolabs). Briefly ...
-
bioRxiv - Immunology 2022Quote: Single mutations of the spike protein were generated via two PCR fragments of the spike ORF using high-fidelity Phusion polymerase (New England Biolabs, USA). The first fragment was generated via a generic forward primer (pCAGGS-5 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... a total of 575 embryos were injected with a mixture containing 300 ng/μL of sgRNA (one guide) and 600 ng/μL of Cas9 protein (NEB, M0641) while for Dll ...
-
bioRxiv - Microbiology 2022Quote: ... The SARS-CoV-2 Spike mutant D614G was generated by site-directed mutagenesis using as an input DNA the expression vector encoding SARS-CoV-2 Spike_614D protein (kindly provided by J. Garcia-Arriaza, CNB-CSIC) by Q5 Site Directed Mutagenesis Kit (New England Biolabs, Barcelona, Spain) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: The fusion protein was purified from the clarified supernatants by adding 20 ml of chitin resin (New England Biolabs, cat#S6651S) and incubating with gentle rotation overnight at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... The non-15N 4R tau used for small-scale chemical in vitro crosslinking was phosphorylated using cAMP-dependent Protein Kinase (PKA, catalytic subunit, New England Biolabs #P6000S) according to manufacturer guidelines (25uL reaction at 30°C for 2 hours with 200 μM ATP ...
-
bioRxiv - Biochemistry 2019Quote: ... Immunoblotting was performed using HRP-conjugated anti-maltose binding protein (MBP) monoclonal antibody at 1:10000 dilution (New England Biolabs, #E8038) to verify equal expression levels of each construct.
-
bioRxiv - Synthetic Biology 2021Quote: ... and a maltose binding protein (MBP) (65) and Factor Xa sequence derived from pMAL-c5X vector (New England Biolabs, Ipswich, MA) with a V313A mutation to be consistent with the native E ...
-
bioRxiv - Bioengineering 2020Quote: ... 200-500 ng of the purified PCR product was used as DNA template in 25 μl of coupled in vitro transcription and translation reaction using PURExpress In Vitro Protein Synthesis Kit (New England Biolabs, E6800L). The reaction was incubated at 37°C for 30 minutes ...
-
bioRxiv - Cell Biology 2019Quote: ... were performed with 5-10 μM final protein concentration and 10 μM dye (SNAP-Surface Alexa Fluor488 (New England Biolabs S9129S) or SNAP-Surface Alexa Fluor647 (New England Biolabs S9136S) ...
-
bioRxiv - Synthetic Biology 2021Quote: 8.3 μM bdSUMO-HSPB611–20 fusion protein containing pSer or nhpSer at site S16 of HSPB6 were reacted with 3 units of λ phosphatase (NEB) according to manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2021Quote: ... the TEV protease was removed by incubation of the purified protein with 250 µL amylose resin (New England Biolabs, Hitchin, UK). Protein concentrations were determined by the bicinchoninic acid assay (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... for each co-expressed DF-APOBEC1 protein using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760L) with NEBNext Poly(A ...