Labshake search
Citations for New England Biolabs :
1051 - 1100 of 6184 citations for 4 1 1 2 3 3 3 Hexafluoropropoxy acetophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2022Quote: ... A targeting vector with P2A-CreERT2-T2A-GFP-stop codon-rabbit beta globin polyA sequence flanked by 5’ and 3’ homology arms was generated using NEBuilder HiFi DNA Assembly (NEB) and cloned into a pKO2 backbone plasmid ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Beads were then dried before adding 50 µL DNaseI mix (3 U of DNaseI in 1X DNAse buffer (NEB, #M0303L) and incubated at 37 °C for 10 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a synthetic 391 bp double-stranded DNA fragment encoding 5′-(1st gRNA/scaffold/H1 promoter/2nd gRNA)-3′ was inserted using the NEBuilder HiFi assembly system (NEB). Synthetic DNA fragments were ordered from Genewiz and sequences are listed in Supplementary Table 3 ...
-
bioRxiv - Systems Biology 2023Quote: Mutated or wild type sequences of RORC 3’UTR were cloned into the dual GFP-mCherry reporter using MluI-HF and PacI restriction enzymes (NEB) as described above ...
-
bioRxiv - Genomics 2022Quote: ... pJR98 was digested by AscI and ssDNA oligo donors of the sequence 5’ CTCTTCCTGCCCGACCTTGGGG – reverse complement IBC – CAGCGCCATAGCTGAGTGTAGATTCGAGC – 3’ were cloned into the vector using NEBuilder HiFI DNA Assembly Master Mix (NEB). Third ...
-
bioRxiv - Cell Biology 2023Quote: ... Two gRNAs targeting UBAP2L (5’-TGGCCAGACGGAATCCAATG-3’ and 5’-GTGGTGGGCCACCAAGACGG-3’) were cloned into pX330-P2A-EGFP/RFP (Zhang et al, 2017) through ligation using T4 ligase (New England Biolabs) using the following primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... Non-IRES mRNAs were capped the 3’-O-Me-m7G(5’)ppp(5’)G anti-reverse cap analog (NEB # S1411L). IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5′ phosphorylated and 3’ A-tailed by NEBNext Ultra II End Prep Enzyme Mix following the manufacturer’s instruction (New England Biolabs #E7645L). An adaptor was ligated ...
-
bioRxiv - Biochemistry 2023Quote: ... 5′ FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 3′) and the Luna Universal Probe one-step RT-qPCR kit (catalog no. E3006; New England Biolabs). A 20-μL RT-qPCR mixture contained 7 μL of sample ...
-
bioRxiv - Biochemistry 2023Quote: ... The array DNA was composed of a fluorescent nucleotide Alexa Fluor 647-aha-dCTP (ThermoScientific) and was generated using Klenow Fragment 3’ – 5’ exo- (NEB). Nucleosome arrays were mixed with SUV420H1 or 5μM HP1α and incubated at room temperature for 20 mins before transferring to a glass bottom 384 well plate for imaging ...
-
bioRxiv - Cancer Biology 2023Quote: ... and PCR amplification of the WPRE sequence and barcode with insertion into the ClaI sites proximal to the 3’ LTR by HiFi DNA Assembly (New England Biolabs). ORFs were cloned into the EcoRI site of the double-barcoded lentiviral vectors by HiFi DNA Assembly ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with 15 µl of anti-MBP couped beads (pre-blocked for 1h in RIPA with 3 % BSA; NEB) for 2 h ...
-
bioRxiv - Cell Biology 2024Quote: ... the newly produced CENP-A-SNAP pool was labelled by exposing the mitotic cells to media containing 3 µM SNAP-Cell 647 (NEB) and 5 µM STLC (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using a 5′ DNA adenylation kit at the 5′ end (NEB). To reduce ligation bias ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the radiolabeled 3’ fragment was ligated to an unlabeled 5’ fragment by splinted ligation with T4 DNA ligase (NEB) at 30°C for 2 h ...
-
bioRxiv - Genomics 2024Quote: ... The backbones for the Gibson reaction for GRB2-SH3 and PSD95-PDZ3 library assembly (aPCA plasmids) were first linearized using primers listed in Extended Data Table 3 and next treated with Dpn1 (NEB) restriction enzyme to remove the circular plasmid template ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then ligated to the 3’ end of the cDNA by using Thermostable 5’ App DNA/RNA Ligase (New England Biolabs) for 2 h at 65°C ...
-
bioRxiv - Neuroscience 2024Quote: Total RNA was isolated from frozen hDRG tissue and GBP- or vehicle-treated primary hDRG cultures (n = 3 per condition) using the Monarch Total RNA Miniprep Kit (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2024Quote: ... amplified with outside primers corresponding to the 5’ constant sequence and the reverse complement of the 3’ constant sequence in 17 cycles using Phusion Polymerase (New England Biolabs), and then inserted into BbsI-digested pLib6.6 using the NEB HiFi Assembly Master Mix Library.The reaction was electroporated into E ...
-
bioRxiv - Genetics 2024Quote: ... containing a T-overhang for the 5’ and 3’ ends of the fragments were ligated to the fragments using TA-ligation with the Quick Ligation Kit (NEB, M2200L ...
-
bioRxiv - Microbiology 2024Quote: ... A deoxycytidine homopolymer tail (C-tail) was added to the 3’ end of the linear extension products using terminal deoxynucleotidyl transferase (TdT; New England Biolabs). The reaction was carried out at 37 °C for 1 hour ...
-
bioRxiv - Molecular Biology 2024Quote: ... The oligonucleotide-based DNA substrate used for the helicase and nuclease assays was generated by labeling the BIO100C oligonucleotide (see Table S1 for oligonucleotides sequence) at the 3’ end using terminal transferase (New England Biolabs) and [α-32P]dCTP (Hartmann Analytic ...
-
bioRxiv - Molecular Biology 2024Quote: ... A second adapter was then ligated to the 3’OH of the cDNAs (with NEB HC RNA Ligase in NEB ligation buffer plus 5% DMSO ...
-
bioRxiv - Immunology 2024Quote: ... A custom ribonucleoside blend was used comprising 3′-O-Me-m7G(5′)ppp(5′)G cap analog (New England Biolabs), ATP ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and then adenylated at the 5′ end with a 5′ DNA adenylation kit (NEB). Four random nucleotides were added in the 3′ and 5′ adapters [(5′ -rAppNNNNTGGAATTCTCGGGTGCCAAGG/amino CA linker-3′ ...
-
bioRxiv - Biochemistry 2024Quote: ... cDNA was PCR amplified using the primers directed against 5′ and 3′ RNA cassettes and NEB Q5 HotStart polymerase (NEB). To introduce unique barcodes ...
-
bioRxiv - Synthetic Biology 2024Quote: ... signal was synthesized by Integrated DNA Technologies and inserted at the 3’UTR of the L1 mRNA using Hifi Assembly mix (NEB). gBlocks gene fragments containing different PBS site sequences were synthesized by Integrated DNA Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: Libraries of immunoprecipitated DNA were generated from 3 ng of starting DNA with the NEBNext Ultra DNA Library Prep kit for Illumina (New England Biolabs) according to manufacturer’s instructions at the CRG Genomics Core Facility (Barcelona ...
-
bioRxiv - Molecular Biology 2024Quote: ... primer O3P (Supplementary Table 3) was attached to IP-purified DNA and was extended by NEBNext Ultra II Q5 Master Mix (New England Biolabs), followed by ExoI (New England Biolabs ...
-
bioRxiv - Immunology 2024Quote: ... the wild type and mutant pBlueScript SK(+) HEV plasmids were linearized at their 3′ end with the MluI restriction enzyme (NEB) and transcribed with the mMESSAGE mMACHINE T7 Transcription kit (Ambion #1344) ...
-
bioRxiv - Biophysics 2024Quote: ... A 30 nt 3′ overhang was created by treating the purified PCR product with USER enzyme mix (NEB, Cat# M5505S) for 15 min at 37°C ...
-
bioRxiv - Systems Biology 2024Quote: ... 3 ug of plasmid was digested in a 3X restriction enzyme reaction containing 15 uL Digestion rCutSmart Buffer (NEB, B6004), 3 µL BsiWI-HF (NEB ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Illumina sequencing libraries were prepared by amplifying 50 µL of each cDNA sample with sequencing adapters (500 nM each library amplification primer, Supplementary Table 3) using the NEBNext Q5 High Fidelity 2x PCR Kit (NEB) under the following cycling conditions ...
-
bioRxiv - Biochemistry 2024Quote: ... 1.5 ml fractions of the protein pool were incubated with 3-fold molar excess of SNAP-Surface Alexa Fluor 546 or SNAP-Surface Alexa Fluor 647 (New England Biolabs) overnight at 4 °C ...
-
bioRxiv - Biochemistry 2024Quote: Cas13a Alcr open reading frames were amplified with T7 forward and reverse primers (Supplementary Table 3) using 2X Q5 polymerase Master Mix (NEB) and purified with QiaQuick PCR clean up (Qiagen) ...
-
bioRxiv - Biochemistry 2024Quote: ... either at the 5’ or 3’ of the trimerization domain and then inserted into a pET29b+ vector using PaqCI (NEB). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: ... RA2 reverse primer 5’-GAGTCGTTCGAATTCTTATGAGTCCGCCGGACGTCTCCGCA CATG-3’) and sub-cloned into pET28 (MilliporeSigma) using Nde1 and EcoR1 restriction enzymes and T4 DNA ligase (New England Biolabs). Similarly ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of 2 U L-1 ExoI (NEB) was added and incubated at 37 °C for 30 minutes then 80 °C for 20 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... in 1 x GlycoBuffer-2 (Biolabs). After incubation for 60 min at 37 °C ...
-
bioRxiv - Synthetic Biology 2024Quote: ... (2) 1 µL of DpnI (NEB) was added and incubated at 37°C for two hours ...
-
bioRxiv - Genomics 2021Quote: ... and washed 3 times with ice-cold 10 mM Ribonucleoside Vanadyl Complex (RVC) (New England BioLabs, cat.no. S1402S, Ipswich, Mass, USA) in buffer A (10 mM NaCl ...
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Molecular Biology 2021Quote: Telomeric duplex DNA 5′-GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGCCCCTC-3′ and antisense (5′-GAGGGGCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC-3′ was end-labeled with [γ-32P]ATP (Amersham Biosciences) and T4-polynucleotide kinase (New England BioLabs) and purified from free nucleotides through G25 spin columns (GE Healthcare) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3’UTRs were combined to the TagRFP-T CDS using the Gibson assembly Master Mix (Cat#E2611, New England BioLabs Inc). The resulting fragment was then amplified via PCR and digested prior ligation into a vector containing only Hofstenia promoter region ...
-
bioRxiv - Cell Biology 2022Quote: ... The mixture was incubated for 3 days at 37 °C in the dark for conjugation and purified for 3 rounds using Monarch® PCR & DNA Cleanup Kit (5 μg) (Cat# T1030S, NEB) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid was linearized with SacI or XhoI (for transcription from T7 or SP6 promoter respectively) and 3’UTR fragment was transcribed in vitro using SP6 or T7 polymerases (New England Biolabs, UK) and the DIG RNA labelling Mix (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The DNA probes were complimentary to the 3′-UTR regions immediately adjacent to the poly(A) tails and were labeled with T4 PNK (NEB, M0201S) and [γ-32P]ATP (PerkinElmer) ...
-
bioRxiv - Cell Biology 2022Quote: ... 200 pmol of an equimolar mixture of all gene-specific oligos for each gene were mixed with 250 pmol of the appropriate FLAP oligo in 1x NEBuffer 3 (New England Biolabs, B7003), then incubated in a Thermocycler (BioRad ...
-
bioRxiv - Genomics 2022Quote: ... an adenylated 5’ end and a dideoxycytosine blocked 3’end – was ligated to size-selected small RNAs using T4 Rnl2tr K227Q (NEB, M0351L) for 16 hours at 25°C ...
-
bioRxiv - Genomics 2020Quote: ... The PCR product and pGAD-C1 vector were digested with ClaI (5’-ATCGAT-3’, New England BioLabs Inc., MA, CA#R0197S) and SalI (5’-GTCGAC-3’ ...