Labshake search
Citations for New England Biolabs :
1051 - 1100 of 3709 citations for 1 1' Diethyl 4 4' bipyridinium dibromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Chromosomal DNA (1 µg) was digested with 10 units (1 µl) of restriction enzyme AciI (New England Biolabs (NEB)) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Chromosomal DNA (1 µg) was digested with 10 units (1 µl) of restriction enzyme AciI (New England Biolabs (NEB)) for one hour at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 µL of 1 µM Cas9 Nuclease (diluted from 20 µM stock in 1X NEBuffer r3.1) (NEB; catalog # M0386T), and 1X NEBuffer 3.1 (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... while the ter region was amplified using the primer pair 3778_ter 1 qPCR fwd with 3778_ter 1 qPCR rev and the Luna Universal qPCR Master Mix (New England Biolabs). Quantification of the ori/ter ratio was performed using the the 2-ΔCT method as described [62].
-
bioRxiv - Molecular Biology 2023Quote: ... in a 10 μL reaction in buffer (50 mM Tris-HCl pH 7.5, 1 mM DTT, 1 U/μL RNase Inhibitor (NEB)) and incubated for 1 hour at 37°C ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR products were inserted into pET28a using restriction digestion and ligation with EcoR 1 and Sal 1 (NEB) sites.
-
bioRxiv - Microbiology 2023Quote: ... This digestion was performed on 1-3 µg of the PCR2 product with 1 µL of exonuclease (NEB #M0262) at 37°C for 30 min before heat inactivation ...
-
bioRxiv - Plant Biology 2023Quote: ... The precipitates were eluted into 30μL 1×SDS loading buffer and detected using anti-Myc and anti-MBP antibody (1:5,000, New England Biolabs).
-
bioRxiv - Genetics 2023Quote: ... 12% PEG-8000, 1 mM dNTPs, 1 μM second strand synthesis primer (AAGCAGTGGTATCAACGCAGAGTGAATG, Sangon) and 0.125 U/μL Klenow exo- (BioLabs)) at 37 °C for 1 h with rotation ...
-
bioRxiv - Bioengineering 2024Quote: ... were mixed in molar ratio 1:1 and 0.37 pmol of total DNA was then treated by Gibson Assembly Master Mix (New England Biolabs) for 3 hours at 50°C ...
-
bioRxiv - Neuroscience 2024Quote: ... pH 8.0) for 1 h at 37 °C and washes in CSTX buffer (1× CutSmart buffer (New England Biolabs (NEB) B60004) ...
-
bioRxiv - Genomics 2024Quote: ... beads were resuspended in 1 ml binding buffer (as described above) including 1 μl of fusion enzyme Nt.CviPII-pGL (NEB) for 1 hr at RT ...
-
bioRxiv - Genomics 2024Quote: ... 1 µL Pr_P7 (10 µM; Supplementary Table 1) and 0.5 µL Vent (exo-) DNA Polymerase (NEB 2 U/µL). The PCR program comprised an initial denaturation step (95°C ...
-
bioRxiv - Genomics 2024Quote: ... was utilized using 1 µg gDNA and the pre-annealed NEB adapter (NEB_P7, NEB_P5, 15 µM; Supplementary Table 1). The manufacturer’s instruction was followed without performing the USER enzyme step ...
-
bioRxiv - Cell Biology 2020Quote: ... Annealed handles were mixed with the purified 21 kb ARS1-DNA at a molar ratio of 15:1 and ligated with T4 DNA Ligase in 1 × T4 ligase buffer (both NEB) at 16 °C overnight ...
-
bioRxiv - Molecular Biology 2020Quote: ... then overnight at 25°C with another 100 μl of the same buffer containing 2.7 μl END-seq adaptor 1 and 1 μl high concentration T4 DNA Ligase (NEB M0202M). After rinsing twice with 1 ml tris buffer ...
-
bioRxiv - Genomics 2020Quote: ... The crRNA and tracrRNA with Alt-R modification (Integrated DNA Technologies) were annealed in a 1:1 ratio to form gRNA that was used in the Cas9 (New England Biolabs) digestion of the SMRTbell libraries ...
-
bioRxiv - Immunology 2021Quote: ... one as Cytosolic Extraction Buffer (CEB) (HEPES 10 mM; KCl 60 mM; EDTA 1 mM; NP40 1%) and another one as Nuclear Extraction Buffer (NEB) (HEPES 20 mM ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR product was cloned into NdeI-SapI site of the expression vector pTXB-1 (Table 1, New England Biolabs) with a C-terminally tagged chitin binding domain (CBD ...
-
bioRxiv - Molecular Biology 2022Quote: ... 10 μL of previously assembled Cas9-RNP complex was added together with 1 μL of dATP (10 mM) and 1 μL of Taq polymerase (NEB) and incubated at 37ºC for 20 minutes and at 72ºC for five minutes for A-tailing ...
-
bioRxiv - Molecular Biology 2022Quote: ... The L5 RNA linker at 1 μM concentration (Table S1) was ligated to RNA in a 20 μl reaction using by 1 U/ μl of RNA Ligase 1 (NEB) in the presence of 15% PEG8000 ...
-
bioRxiv - Biophysics 2022Quote: ... These SETD3 mutants were introduced into either EcoRV-digested pLenti-CMV-Puro-Dest (w118-1) or EcoRV-digested pLenti-CMVTRE3G-Puro-DEST (w811-1) by Gibson Assembly (New England Biolabs).
-
bioRxiv - Biophysics 2022Quote: ... These SETD3 mutants were introduced to either EcoRV-digested pLenti-CMV-Puro-Dest (w118-1) or EcoRV-digested pLenti-CMVTRE3G-Puro-DEST (w811-1) by Gibson Assembly (New England Biolabs).
-
bioRxiv - Biophysics 2022Quote: ... These SETD3 mutants were introduced to either EcoRV-digested pLenti-CMV-Puro-Dest (w118-1) or EcoRV-digested pLenti-CMVTRE3G-Puro-DEST (w811-1) by Gibson Assembly (New England Biolabs).
-
bioRxiv - Plant Biology 2021Quote: ... RNA adapters with a 5’ inverted dT modification (See Supplementary Table 1) were ligated to the DNase- treated RNA by T4 RNA ligase 1 (#M0204S, New England Biolabs) to render the canonical cleavage products not available for subsequent ligation reaction ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were ligated to barcode primers 1-20 of NEBNext Index Primers for Illumina sets 1 and 2 (New England Biolabs) and libraries analysed using DNA High Sensitivity chip on an Agilent 2100 Bioanalyzer before being pooled ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 mM sodium ascorbate before collecting them by scraping in 1 mL of the same solution with Murine RNase Inhibitor (1:1000, NEB). Cells were collected in a microcentrifuge tube ...
-
bioRxiv - Genomics 2021Quote: ... End fill-in and A-tailing were performed by addition of Klenow Fragment 3’ --> 5’ exo-(Enzymatics) and dNTP mix (10 mM dATP, 1 mM dCTP, 1 mM dGTP New England Biolabs). After ligation to methylated Illumina TruSeq LT v2 adaptors using T4 DNA Ligase rapid (Enzymatics) ...
-
bioRxiv - Biochemistry 2021Quote: ... were 3′ end-radiolabeled by incubation for 1 hr at 16°C with 1.11 MBq [5′-32P] cytidine-3′,5-bisphosphate (222 TBq mmol−1, Hartmann Analytic) and 10 units T4 RNA ligase 1 (NEB) in a total reaction volume of 20 µl containing 15% (v/v ...
-
bioRxiv - Cell Biology 2020Quote: 50 μl of lysed cells were aliquoted to 8 tubes containing 450 μl of digestion mix (1x NEB 1 buffer, 1% triton X-100, and 100 U HpaII enzyme (NEB)) and incubated at 37°C for 3 hours with constant shaking ...
-
bioRxiv - Neuroscience 2020Quote: ... + 5 % non-fat milk for 1 hour at room temperature before incubating with primary antibody: anti-GFP (1:1000, Biolabs) or anti-actin (1:5000 ...
-
bioRxiv - Biochemistry 2022Quote: BsmBI-digested vector and insert were ligated in a molar ratio of 1:100 to a total of 1 μg using T4 DNA ligase (NEB) for 2 h at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... was added reconstituted with 1 μg of purified recombinant αS (vendor) in 1 μL of 5X RNA Polymerase Reaction Buffer (New England Biolabs) and incubated at 4°C for 15 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... ligation reactions with T4 DNA ligase were prepared: 1 μM of ssPCRP was added to 1 μM complementary strands in 1X T4 ligation buffer (NEB) in a final volume of 10 μL ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The coding and reverse oligonucleotides were mixed (6 µL H2O, 1 µL T4 Ligase Buffer, 1 µL T4 PNK (10 U/µL; NEB), 1 µL of each 100 µM oligonucleotide ...
-
bioRxiv - Molecular Biology 2024Quote: ... adding nuclease-free water to a final volume of 1 L) with 1:1000 (vol/vol) proteinase K (New England Biolabs) at 37°C for 1 h ...
-
The RNA-binding protein RbpB is a central regulator of polysaccharide utilization in gut BacteroidesbioRxiv - Microbiology 2023Quote: ... 20 pmol of the dephosporylated RNA were 5’-end-labeled (20 µCi of 32P-γATP) in a 20 µL reaction for 1 h at 37°C using 1 U polynucleotide kinase (NEB). Labeled RNA was purified on a G50-column (GE Healthcare ...
-
bioRxiv - Biophysics 2024Quote: ... Splint ligation reaction was done by mixing DNA in equal molar ratios of 1 mM in a 20 μl reaction and annealed in 1✕ ligation buffer (NEB) over 4 hours using a thermocycler (bio-rad) ...
-
bioRxiv - Bioengineering 2024Quote: ... containing 0.06 % pluronic acid (F-127, final concentration) and 1 µL of each disulfide bond enhancer 1 and 2 (NEB #E6820). We used droplet oil consisting of 3M™ Novec™ HFE7500 Engineered Fluid (3M ...
-
bioRxiv - Synthetic Biology 2023Quote: Gel electrophoresis was performed using 1 % agarose gels and the ladders used were either Quick-Load 1 kb Extend DNA Ladder (NEB), or Quick-Load Purple 1 kb plus DNA Ladder (NEB).
-
bioRxiv - Microbiology 2023Quote: ... The membrane was washed three times in TBS-T for 5 min each before incubation for 1 h with secondary antibody (anti-rabbit IgG HRP, 1:5000 dilution, 7074S, NEB) in TBS-T with 1% (w/v ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 μg of cDNA was amplified with Phusion polymerase for 32 cycles and separated on a standard 1% agarose gel together with a 100 bp or 1 kb ladder (New England Biolabs). Ribosomal protein L32 (RpL32 ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was PCR amplified (primers hFUR Exon 1-3 PCR For and hFUR Exon 1-3 PCR Rev) and purified (Monarch PCR & DNA cleanup kit, NEB). The resulting PCR product was sequenced using the hFur Exon 1 Seq primer.
-
bioRxiv - Genomics 2023Quote: ... beads were incubated with 10 µL of USER mix (1 µL of 10X USER buffer and 1 µL of USER enzyme in 8 µL of nuclease-free water, NEB) and incubated at 37°C for 15 minutes ...
-
bioRxiv - Biochemistry 2022Quote: ... 50 μg of supercoiled pUBER plasmid was treated with 1 unit/μg Nt.BbvCI in 1 × Cutsmart buffer (New England Biolabs, USA) at 37°C for 4 h ...
-
bioRxiv - Biochemistry 2023Quote: ... were ligated to 50 pmol RNA oligonucleotide “20.25” (5’-UCG AAG UAU UCC GCG UAC GU-3’, Dharmacon) with 1 µL T4 RNA ligase 1 (NEB, #M0204S) for 1 h at 16 °C in 15% (v/v ...
-
bioRxiv - Biophysics 2023Quote: ... and a reverse elongation primer (Supplementary Tables 1 and 2) and incubating for 1 cycle of annealing/extension with Q5 polymerase (New England Biolabs). dsDNA product was then incubated with ExoSAP-IT (Applied Biosystem ...
-
bioRxiv - Cancer Biology 2023Quote: Fresh omentum and omental HGSOC tumor metastasis biopsy samples were cut into small pieces and dissociated in digestion solution (1 mg/mL collagenase/Dispase [Sigma cat. no. 10269638001], 1 unit/mL DNase I [NEB, cat ...
-
bioRxiv - Microbiology 2023Quote: ... A 1 ml aliquot of cells was incubated with 1 μl M13KO7 (1011 plaque-forming units per ml, pfu/ml) (NEB) for 10 min on ice to allow attachment ...
-
bioRxiv - Neuroscience 2024Quote: ... The cut organoids were placed in pre-warmed Accutase supplemented with 1:2000 DNAseI and 1:2000 RNAase Inhibitor (both NEB), and slowly pipetted up and down using wide-bore pipette tips ...