Labshake search
Citations for New England Biolabs :
1001 - 1050 of 1099 citations for Recombinant Mouse Icam1 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: The CAG-HA-RBMS3-PCDH cDNA expression plasmid was cloned using a cDNA template made from RNA from the lungs of a wild-type mouse using the Q5 polymerase (NEB) and restriction endonuclease cloning with the following primers ...
-
bioRxiv - Neuroscience 2021Quote: ... One piece of mouse frontal cortex tissue (6-10 mg) was placed in 3 ml of ice-cold nuclei extraction buffer (NEB) [0.32 M sucrose ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 μg of total RNA was depleted of rRNA using NEBNext rRNA Depletion Kit (Human/Mouse/Rat) prior to cDNA synthesis primed with random hexanucleotide oligonucleotides (Random Primer 6, NEB). Sequencing library construction was carried out using NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Cell Biology 2019Quote: ... Standard qualitative PCRs to check for the general abundance of distinct SPIRE1 splice variants were performed employing cDNAs from mouse brain tissue and Q5 High-Fidelity DNA polymerase (New England Biolabs). Expression vectors encoding mouse SPIRE1 ...
-
bioRxiv - Immunology 2020Quote: ... Single antigen specific memory B cells were sorted on BD FACS Aria II into 96-well PCR plates (Axygen) containing 10 μl per well of lysis buffer (10 mM DPBS, 4 U Mouse RNase Inhibitor, NEB). Plates were immediately frozen on dry ice and stored at 80 C or processed for cDNA synthesis.
-
bioRxiv - Immunology 2023Quote: ... The custom sgRNA vector used in this study was a hybrid AAV-SB-CRISPR plasmid for targeting primary mouse NK cells (AAV-SB100x) that was constructed by gBlock fragments (IDT) followed by Gibson Assembly (NEB). The Surf-v2 library was cloned into the AAV-SB-CRISPR vector by pooled cloning to generate the AAV-SB-Surf-v2 plasmid library.
-
bioRxiv - Neuroscience 2023Quote: ... To generate these constructs gene block fragments that codify for those sequences were produced in the Duke Transgenic Mouse Facility and cloned into the backbone using EcoRI-HF Restriction Enzyme (NEB) and In-Fusion HD Cloning Kit (Takara ...
-
bioRxiv - Molecular Biology 2023Quote: ... The corresponding regions of a partial mouse Azin1 gene were amplified from mouse tail genomic DNA by using Phusion Hot Start Flex 2X Master Mix (New England Biolabs) and the following primers ...
-
bioRxiv - Cancer Biology 2022Quote: ... rRNA depletion was performed using a NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) and RNA was purified using Agencourt RNAClean XP Beads (New England Biolabs). Libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) ...
-
bioRxiv - Immunology 2024Quote: N-linked glycans were enzymatically released from purified mouse THP using PNGase-F kit (catalog no P0709S, New England Biolabs). N-glycans were then purified from the reaction mixture containing denaturing buffer and de-N-glycosylated proteins by solid phase extraction method using Sep-Pak C18 (1 cc Vac-cartridges ...
-
bioRxiv - Microbiology 2024Quote: ... AnTat1.1 sequence was obtained from AnTat1.1 specific cDNA from mouse infection D6 cloned into a pMiniT vector with the PCR Cloning Kit (NEB, E1202S). VSG-228 was partially amplified from VSG PCR (see below ...
-
bioRxiv - Molecular Biology 2019Quote: ... of pA-Dam protein was incubated with 500 ng of unmethylated plasmid in 20 µL of 1x dam MethylTransferase buffer (New England BioLabs #M0222S) supplemented with 80 µM S-adenosylmethionine (SAM ...
-
bioRxiv - Biochemistry 2020Quote: In vitro trans-translation assays were performed using the PURExpress In Vitro Protein Synthesis and Δ Ribosome kits (New England Biolabs). For trans-translation assays ...
-
bioRxiv - Genomics 2021Quote: ... Samples were then combined and AMII adapters containing the motor proteins needed for sequencing were ligated using NEBNext® Quick Ligation Module (NEB). AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Biochemistry 2020Quote: ... Beads were resuspended in 1 volume of buffer A / 300 mM NaCl / 2 mM MnCl2 / 1 mM DTT and incubated with λ protein phosphatase (NEB) at 50 U / mL for 1 hour at 23°C with agitation ...
-
bioRxiv - Biochemistry 2021Quote: ... The RNAs were recovered from the gel slices by digesting the protein with proteinase K (8 U; P8107S, NEB, Ipswich, MA) leaving a polypeptide remaining at the crosslinked nucleotide ...
-
bioRxiv - Plant Biology 2020Quote: 20-33 kD subregions of NRPD1 and RDR2 polypeptides were expressed in vitro using a PURExpress® In Vitro Protein Synthesis Kit (New England Biolabs). Briefly ...
-
bioRxiv - Immunology 2022Quote: Single mutations of the spike protein were generated via two PCR fragments of the spike ORF using high-fidelity Phusion polymerase (New England Biolabs, USA). The first fragment was generated via a generic forward primer (pCAGGS-5 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... a total of 575 embryos were injected with a mixture containing 300 ng/μL of sgRNA (one guide) and 600 ng/μL of Cas9 protein (NEB, M0641) while for Dll ...
-
bioRxiv - Microbiology 2022Quote: ... The SARS-CoV-2 Spike mutant D614G was generated by site-directed mutagenesis using as an input DNA the expression vector encoding SARS-CoV-2 Spike_614D protein (kindly provided by J. Garcia-Arriaza, CNB-CSIC) by Q5 Site Directed Mutagenesis Kit (New England Biolabs, Barcelona, Spain) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: The fusion protein was purified from the clarified supernatants by adding 20 ml of chitin resin (New England Biolabs, cat#S6651S) and incubating with gentle rotation overnight at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... The non-15N 4R tau used for small-scale chemical in vitro crosslinking was phosphorylated using cAMP-dependent Protein Kinase (PKA, catalytic subunit, New England Biolabs #P6000S) according to manufacturer guidelines (25uL reaction at 30°C for 2 hours with 200 μM ATP ...
-
bioRxiv - Biochemistry 2019Quote: ... Immunoblotting was performed using HRP-conjugated anti-maltose binding protein (MBP) monoclonal antibody at 1:10000 dilution (New England Biolabs, #E8038) to verify equal expression levels of each construct.
-
bioRxiv - Synthetic Biology 2021Quote: ... and a maltose binding protein (MBP) (65) and Factor Xa sequence derived from pMAL-c5X vector (New England Biolabs, Ipswich, MA) with a V313A mutation to be consistent with the native E ...
-
bioRxiv - Bioengineering 2020Quote: ... 200-500 ng of the purified PCR product was used as DNA template in 25 μl of coupled in vitro transcription and translation reaction using PURExpress In Vitro Protein Synthesis Kit (New England Biolabs, E6800L). The reaction was incubated at 37°C for 30 minutes ...
-
bioRxiv - Cell Biology 2019Quote: ... were performed with 5-10 μM final protein concentration and 10 μM dye (SNAP-Surface Alexa Fluor488 (New England Biolabs S9129S) or SNAP-Surface Alexa Fluor647 (New England Biolabs S9136S) ...
-
bioRxiv - Synthetic Biology 2021Quote: 8.3 μM bdSUMO-HSPB611–20 fusion protein containing pSer or nhpSer at site S16 of HSPB6 were reacted with 3 units of λ phosphatase (NEB) according to manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2021Quote: ... the TEV protease was removed by incubation of the purified protein with 250 µL amylose resin (New England Biolabs, Hitchin, UK). Protein concentrations were determined by the bicinchoninic acid assay (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... for each co-expressed DF-APOBEC1 protein using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760L) with NEBNext Poly(A ...
-
bioRxiv - Microbiology 2022Quote: ... Purified protein (4 μg) was deglycosylated with 500 U of Endoglycosidase H (Endo H) (New England Biolabs, Ipswich, MA, United States) according to the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2023Quote: ... Strep–PIF4 recombined proteins were expressed in the Escherichia coli BL21 (DE3) strain and then purified using amylose resin (NEB, E8021S). DNA probes of NHX1 and SAL1 were synthesized and labeled using the Biotin 3′ End DNA Labeling Kit (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... the particles were captured by magnetic stand and proteins captured by the particles were separated by SDS-PAGE and examined by immunoblotting using MBP antibody (NEB, #E8032S). For the immunoblot ...
-
bioRxiv - Developmental Biology 2023Quote: ... The MBP-Pkc53E and MBP-Pkc53EEDDD fusion proteins were bacterially expressed and purified with Amylose resin (New England Biolabs, Frankfurt, Germany). Additionally ...
-
bioRxiv - Synthetic Biology 2023Quote: ... we constructed the genetic sequence of the major shell protein of 50nmGVs using Q5 DNA polymerase and Gibson assembly kits (New England Biolabs Inc.)65 ...
-
bioRxiv - Microbiology 2023Quote: ... Each protein was then isolated and affinity-purified using an amylose resin according to the manufactureŕs protocol (New England Biolabs, Ipswich, US) and the concentration was determined using the Bradford technique ...
-
CXCL17 binds efficaciously to glycosaminoglycans with the potential to modulate chemokine signallingbioRxiv - Immunology 2023Quote: ... WT SUMO3-CXCL17 and variants were expressed as soluble proteins in SHuffle® T7 Competent E.coli (New England Biolabs, Hitchin, UK). In both protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... The protein was then purified by affinity-purification using an amylose beads according to the manufacturer’s protocol (New England Biolabs, Ipswich, USA) and the concentration determined by Bradford assay ...
-
bioRxiv - Cell Biology 2023Quote: Beads with bound Flag-RAD50 or GFP-BRCA1 were washed with 5M NaCl to eliminate contamination with protein kinases and incubated with 100 or 500 U of CK2 holoenzyme complex (α2/β; NEB) in 30 μl of kinase buffer (20 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Biophysics 2023Quote: ... Trypsin digestion was initiated by adding 1:10 (trypsin to protein, m/m) mass spectrometry grade trypsin (New England Biolabs #P8101S) in 50 mM ammonium bicarbonate ...
-
bioRxiv - Biochemistry 2024Quote: ... the crude extract containing 100 μg (in 100 μL volume) of proteins was treated with 400 units of λ-PPase (#P0753; New England Biolabs) for 60 min at 30 °C ...
-
bioRxiv - Biophysics 2023Quote: Tau was phosphorylated in vitro according to previous protocols with some modifications.12,88 50 µL of 100 µM tau was incubated with 2 µg cAMP-dependent Protein Kinase (PKA, New England BioLabs P6000S) and/or 0.4 µg GSK3β (Sigma-Aldrich G4296 ...
-
bioRxiv - Cell Biology 2024Quote: All purified SNAP-tagged proteins were labeled with 10-fold molar excess of SNAP-Surface dyes (New England Biolabs, Ipswich, MA) in labeling buffer (1× PBS ...
-
bioRxiv - Immunology 2021Quote: Point or deletion mutations were prepared from human or mouse CRT expression clones in pCMV3-C-Myc (SinoBiological) using the Q5® Site-Directed Mutagenesis Kit (NEB) according to the manufacturer’s protocol and primers designed using the NEBaseChanger™ web tool ...
-
bioRxiv - Systems Biology 2020Quote: ... rRNA depletion and library preparation for sequencing was completed with the NEBNext protocol (‘Protocol for use with NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E6310) and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760 ...
-
bioRxiv - Neuroscience 2021Quote: The moPrP-eGFP_39/40 fusion construct carrying eGFP within the flexible N-terminal tail between aa 39 and 40 of mouse PrP was created using NEB® Golden Gate Assembly (New England Biolabs). In brief ...
-
bioRxiv - Cancer Biology 2020Quote: ... we performed eight 100 μl PCR reactions per sample (4 μg DNA per reaction, 32 μg per mouse) using Q5 High-Fidelity 2x Master Mix (New England Biolabs, M0494X). The PCR products were purified with Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2022Quote: ... DNA fragments ranging from 3 kb to 5 kb with 40-100 bp terminal homologies were amplified from mouse BAC RP23-51O13 with Q5 polymerase (NEB, M0491L). Approximately equal amount (100 ng ...
-
bioRxiv - Immunology 2020Quote: CAR-encoding mRNA was transcribed from linearized plasmids encoding anti-human CD19 CAR61 and anti-mouse CD19 CAR71 using T7 RNA polymerase (HiScribe™ T7 High Yield RNA Synthesis Kit, New England Biolabs). The mRNAs were transcribed to contain the 5′ UTR derived from the human a-globin 5′ leader RNA ...
-
bioRxiv - Genetics 2020Quote: ... RNA-seq libraries were prepared according to the protocol for use with NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E6310) and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760) ...