Labshake search
Citations for New England Biolabs :
951 - 1000 of 7563 citations for Tert Butyldimethyl 3 4 4 5 5 Tetramethyl 1 3 2 Dioxaborolan 2 Yl Phenoxy Silane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... 4 U of T4 DNA polymerase (NEB), 13.5 U of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 µL RNase H (New England Biolabs), 644 µL buffer A and 2 µL DTT (1M) ...
-
bioRxiv - Biochemistry 2021Quote: ... and 4 U murine RNase inhibitor (NEB). TMAO was adjusted to pH 7.5 in a 6 M stock solution with HCl ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.1 μl 10X NEB 4 buffer (NEB), 0.1 μl 10 mM dCTP and H2O ...
-
bioRxiv - Biophysics 2022Quote: ○ 4 μL Klenow Exo-enzyme (NEB #M0212S) μL
-
bioRxiv - Microbiology 2024Quote: ... 4 µl of 10x Apyrase buffer (NEB) and 1 µl of Apyrase (M0398S ...
-
bioRxiv - Microbiology 2024Quote: ... 4 µl of 10x r3.1 buffer (NEB), 2 µl of 100µM DTT and 1 µl of NudC (M0607S ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 µL 10X CutSmart Buffer (NEB) in a 40 µL reaction ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 μL of Quick CIP (NEB, M0508S) was spiked into the reaction and incubated at 37°C for 30 minutes to dephosphorylate unincorporated dNTPs that may inhibit downstream processes ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 μL of T5 Exonuclease (NEB M0663S) was added to the reaction and incubated at 37°C for 30 minutes to remove unassembled products ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 µL 10X T4 Ligase Buffer (NEB, Cat #B0202S ...
-
bioRxiv - Bioengineering 2024Quote: ... 4 µL 10x T4 ligase buffer (NEB), and water to 40 µL ...
-
bioRxiv - Molecular Biology 2021Quote: ... The repair template was made by annealing oligos described in Supplementary File 3 and extending the 3’ ends using Phusion Polymerase (New England Biolabs, Beverly, MA). SIR3 overexpression strain and its control strain was created by transformation and maintenance of 2-micron plasmids pJR3526 and YEp24 ...
-
bioRxiv - Microbiology 2020Quote: ... and one fragment of about 320 bp of the 3’-terminal region by 3’ RACE were amplified using Phusion High-Fidelity PCR Kit (New England Biolabs, MA, USA) under the following conditions [98°C ...
-
bioRxiv - Neuroscience 2022Quote: ... the full-length msi1 or msi2 human cDNA and the msi-1 3’UTR were fused to a 3 kb fragment of the rig-3 promoter using NEBuilder Hifi DNA assembly (New England Biolabs, Ipswich, MA).
-
bioRxiv - Cancer Biology 2021Quote: ... or a polyclonal rabbit antibody against cleaved casp-3 (1:100; New England Biolabs, Frankfurt, Germany), followed by a biotinylated goat anti-rabbit secondary antibody (Abcam ...
-
bioRxiv - Cancer Biology 2020Quote: ... Positive control slides were treated with 3 U/mL DNase-1 (New England Biolabs, Cat. M0303) for 10 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... Pre-adenylated L3-1R-App 3’ adaptors were ligated using T4 RNA ligase 1 (M0204, NEB) for 75 min at 25°C ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µL of 10% SDS and 3 µL of proteinase K (New England Biolabs, Ipswich, MA) were added to the suspension ...
-
bioRxiv - Molecular Biology 2024Quote: ... Tat or 3’ LTR by ligation using 1 U of T4 DNA ligase (New England Biolabs) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... and A-tailed by mixing 3 µl PCR product + 1 µl 10x Thermopol buffer (NEB M0267S) + 0.2 µl ATP + 1 µl Taq polymerase and incubating the reaction at 70°C for 30 minutes ...
-
bioRxiv - Genetics 2020Quote: ... followed by gap repair by adding 2 µl of 10× NEBuffer 2 (NEB), 3 µl of dNTPs (2.5 mM each ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 2’O-methylated using Vaccinia VP39 (2’O Methyltransferase) (New England Biolabs), then purified by phenol-chloroform extraction and ethanol precipitation.
-
bioRxiv - Bioengineering 2024Quote: ... and 2 µL of 2× Gibson Master Mix (New England Biolabs, Ipswich, MA), the mixture was incubated at 50°C for 15 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... which was treated with 5 units of T7 endonuclease 1 (New England Biolabs) for 20 min at 37 °C and analyzed by 2% agarose gel electrophoresis ...
-
bioRxiv - Cell Biology 2022Quote: ... with 10 mM 10x Adenosine 5’-Triphosphate (1:10, #P0756S, New England Biolabs). The reaction was incubated in a thermocycler for 37 °C for 30 min ...
-
bioRxiv - Genomics 2020Quote: ... 8 μL of 5 M NaCL and 1 μL of RNase A (NEB) were added to every 200 μL of eluate and to the WCE samples (diluted to 200 μL with Elution buffer) ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA 5’ adaptor was ligated using T4 RNA Ligase 1 - high concentration (NEB) and 10 mM ATP ...
-
bioRxiv - Neuroscience 2024Quote: ... the construct was diluted 1:5 with empty pUC19 vector (New England Biolabs) and then transfected with 7.5 µL of TransIT-293 and 2.5 µg of DNA ...
-
bioRxiv - Biophysics 2024Quote: ... PM187B20 was 5’ end labelled using 1 μL T4 polynucleotide Kinase (NEB, M0201S), 1 μL γ 32P ATP (Perkin Elmer ...
-
bioRxiv - Biophysics 2021Quote: ... Fragmented 5’-OH sites were phosphorylated by treatment with 5 units of T4 polynucleotide kinase (NEB) for 1 hour at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... the DTB-GTP cap was removed leaving a 5’ monophosphate terminus using RNA 5’pyrophophohydrolase (NEB), RNA was bound to AMPure beads and eluted in low TE (10mM Tris pH8.0 ...
-
bioRxiv - Immunology 2022Quote: ... Vκcons 5’GGCTGCAGSTTCAGTGGCAGTGGRTCWGGRAC3’ and Jκ5SHM 5’AGCGAATTCAACTTAGGAGACAAAAGAGAGAAC3’ using Phusion High-Fidelity DNA Polymerase (New Englands Biolabs) and according to following program ...
-
bioRxiv - Microbiology 2020Quote: ... followed by 3’ adaptor ligation using T4 ligase (NEB). The ligated products used for reverse transcription with SSIII (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... followed by 3′ adaptor ligation using T4 ligase (NEB). The ligated products were used for reverse transcription with SSIII (Invitrogen ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 µL murine RNase Inhibitors (40 U/µL NEB) and 125 µM NTP-mix (NEB) ...
-
bioRxiv - Biochemistry 2020Quote: ... and 3 μL of CutSmart buffer (New England Biolabs) with 4 μL of sterile water ...
-
bioRxiv - Bioengineering 2021Quote: ... and 3 μl Klenow Fragment (exonuclease-deficient; M0212, NEB). The HDMI-array was incubated at 37 °C for 2 hr in a humidity-controlled chamber.
-
bioRxiv - Microbiology 2020Quote: ... 3’ blocked oligodeoxynucleotide RNA linker (S1315S, New England BioLabs) was ligated to the 3’ ends of RNAs by incubation with RNA ligase 2 ...
-
bioRxiv - Cell Biology 2021Quote: ... Then 3 µl USER® Enzyme (New England BioLabs) was used with size-selected ...
-
bioRxiv - Cell Biology 2021Quote: ... and 3 µl of G3 reaction buffer (NEB, MA) and 2 µl PNGase F (NEB P0704S) ...
-
bioRxiv - Microbiology 2020Quote: ... followed by 3’ adaptor ligation using T4 ligase (NEB). The ligated products used for reverse transcription with SSIII (Invitrogen ...
-
bioRxiv - Biochemistry 2022Quote: ... T4 PNK 3’ phosphatase minus (New England BioLabs, M0236S) was used.
-
bioRxiv - Genetics 2020Quote: ... and 3 cycle barcoding PCR is performed (NEB, E7645S). 2×150bp paired end sequencing data is generated on Illumina HiSeq 4000 at Novogene.
-
bioRxiv - Genetics 2020Quote: ... and 3 cycle barcoding PCR is performed (NEB, E7645S). 2×150bp paired end sequencing data is generated on Illumina HiSeq 4000 at Novogene.
-
bioRxiv - Genomics 2021Quote: ... Then 3 μl of USER Enzyme buffer (NEB, USA) was incubated with size-selected ...
-
bioRxiv - Microbiology 2023Quote: ... a custom 3’ adapter (5ʹ-rAppCTGTAGGCACCATCAAT–NH2-3ʹ, NEB) was ligated to all RNAs following the protocol described in (91) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 3 U BglII (New England Biolabs, Cat. No. R0144S) and 6 U SalI (New England Biolabs ...
-
bioRxiv - Genetics 2023Quote: CAAGCAGAAGACGGCATACGAGAT-3’) and Phusion DNA polymerase (New England Biolabs,
-
bioRxiv - Genomics 2023Quote: ... Each reaction contained 3 uL BbsI (New England Biolabs), 1.25 uL T4 ligase (New England Biolabs) ...