Labshake search
Citations for New England Biolabs :
951 - 1000 of 10000+ citations for Rat Epithelial Discoidin Domain Containing Receptor 1 DDR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: Control and DRP1 gRNA were cloned into a plasmid containing a U6 promoter using BstXI and BlpI restriction enzymes (NEB) (gifted by Dr ...
-
bioRxiv - Cell Biology 2023Quote: ... vector containing aa1-255 of Cnn was digested with KpnI and SspI and a complementary fragment containing the point mutations was cloned into the cut vector using HiFi technology (NEB). The complementary fragment was generated by GENEWIZ ...
-
bioRxiv - Biochemistry 2023Quote: ... The same construct containing a blasticidin-S deaminase (BSD) gene in place of PAC was generated by Gibson assembly (NEB) using primers ZJ1-ZJ4 (Table S2) ...
-
bioRxiv - Genomics 2023Quote: ... we amplified the library using PCR with a 10 µl reaction mixture containing 5 µl of Phusion High Fidelity MASTER Mix (New England Biolabs), 2 µl of P1 primer (AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT CTT TCC CTA CAC GAC G) ...
-
bioRxiv - Cell Biology 2023Quote: ... Double-stranded cDNA was generated by second-strand synthesis via the nick translation method using a mix containing 2Lμl of RNAse H (NEB, #M0297S), 1Lμl of E ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were incubated for 30 min at 37°C in appropriate media containing 3µM of cell-permeable SNAP-Cell® 647-SiR (New England BioLabs). Cells were then rinsed twice with fresh media and incubated for 30min at 37°C ...
-
bioRxiv - Systems Biology 2023Quote: ... and used as the template for PCR with primers containing gene-specific targeting homology arms (1x Q5 Master Mix, New England Biolabs #M0494S ...
-
bioRxiv - Molecular Biology 2023Quote: ... The ends of DNA were repaired by incubating in 70 μL of 1X NEBuffer 2 containing 0.6 units of T4 DNA polymerase (NEB, M0203S), 2 units of T4 polynucleotide kinase (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... was generated using primers 2238–2027 The RNAs were synthesized in 50 μl reactions containing T7 RNA polymerase (25 units; New England Biolabs), 40 mM Tris–HCl (pH 7.9) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli cells and streaked onto Luria-Burtani (LB) plates containing carbenicillin. All-by-all repressor constructs (Fig. 5c) were cloned by digestion with BsiWI-HF (NEB) and BbsI (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Genetics 2023Quote: ... Golden Gate Assembly reaction was carried out in a 100ul reaction containing 2.5U Esp3I (Thermo ER0452) and 1000U T4 DNA Ligase in T4 DNA Ligase reaction buffer (NEB M0202L). The reaction mix was incubated for 31 cycles alternating between 37deg ...
-
bioRxiv - Microbiology 2023Quote: ... RHCas9 Δgra72 parasites were co-transfected with plasmids containing sgRNAs specifically targeting the UPRT locus and SacI (New England Biolabs)-linearized pTwist-CMV: ...
-
bioRxiv - Microbiology 2023Quote: ... RH-Luc+ Δgra47 or ME49-cLuc+ Δgra47 were co-transfected with plasmids containing sgRNAs specifically targeting the UPRT locus (Table S1) and EcoRV (New England Biolabs)-linearized pUPRT::GRA47HA plasmid at a ratio 1:5 of sgRNAs to linearized plasmid ...
-
bioRxiv - Molecular Biology 2023Quote: ... The double stranded DNA templates were then synthesized through a 200 µL PCR reaction containing 10x Taq Buffer (NEB, #B9014S), 250 µM dNTP Mix (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... The genomic DNA region containing the integrated sgRNA was amplified by PCR using Q5 Mastermix Next Ultra II (New England Biolabs) with the LCV2_forward and LCV2_reverse primers (Table S3) ...
-
bioRxiv - Cell Biology 2023Quote: ... zact sequence was amplified with primers containing attB sites (F: GGGGACAAGTTTGTACAAAAAAGCAGGCTCCATGGATGAGGAAATCGCTG; R: GGGGACCACTTTGTACAA-GAAAGCTGGGTAGAAGCACTTCCTGTGGACGATG) using a high-fidelity polymerase (Phusion, NEB). To create a middle entry clone pME-zact ...
-
bioRxiv - Cancer Biology 2023Quote: 20 μL of the lysate DNA containing the peptide library was PCR amplified with Q5 high-fidelity DNA polymerase (New England Biolabs), for 15 cycles in a 50 μL reaction ...
-
bioRxiv - Bioengineering 2023Quote: ... For each round of selection vector DNA corresponding to the insert-containing region was amplified by PCR using either Phusion High-Fidelity enzyme or Q5 polymerase (both from New England Biolabs using Forward primer ...
-
bioRxiv - Cell Biology 2023Quote: ... His-MBP-Mis18BP120-130 was purified using the same lysis buffer containing 500 mM NaCl and purified using amylose resin (NEB). Proteins were then eluted by an elution buffer containing 10 mM Maltose.
-
bioRxiv - Genetics 2024Quote: ... DNA was isolated from HepG2 cells and the regions were amplified with PCR primers containing restriction enzyme (RE) cutting sites for NsiI (New England Biolabs, NEB) and BamHI/HindIII (NEB ...
-
bioRxiv - Immunology 2024Quote: Reverse-transcription on total RNA (100 to 500 ng) was performed with random hexamer/oligo-dT-Primer containing LunaScript RT Supermix (New England Biolabs) following the manufactureŕs instructions ...
-
bioRxiv - Immunology 2024Quote: ... Two microliters were subsequently used in real-time quantitative PCR reactions containing SYBR-green based Luna universal dye qPCR mix (New England Biolabs) and gene specific PCR primers ...
-
bioRxiv - Microbiology 2023Quote: ... MARCH2 mutant constructs containing point mutations and deletions used in this study were generated by SDM using Q5 polymerase (New England Biolabs) and primers listed in Supplemental Table S2 ...
-
bioRxiv - Microbiology 2024Quote: ... The coverslips are then incubated for 30 min at 37°C with DMEM supplemented with 10% SVF containing 0.12 μM SNAP-Cell TMR-Star (New England Biolabs #S9105S), rinsed twice with PBS and incubated for 45 min with Dapi (1μg/ml) ...
-
bioRxiv - Biochemistry 2024Quote: ... and tRNAGln with 5 nt-long 5’ leader and same 24 nt-long 3’ trailer as tRNATyr (5–tRNAGln–24) – were transcribed in reactions containing 1x T7 RNA polymerase reaction buffer (NEB), 0.001% (w/v ...
-
bioRxiv - Cell Biology 2024Quote: ... The amplicons were digested with SacI and EagI ligated into the plasmid containing the ATG8 promoter linearized with HindIII (New England Biolabs) and SalI (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Sequencing libraries were generated by amplifying sgRNA sequences from genomic DNA using bar-coded Illumina-compatible adapter-containing primers and NEBNext High-Fidelity 2x PCR Master Mix (New England BioLabs). PCR products were pooled and purified with a ZymoSpin V column with Reservoir (Zymo Research) ...
-
bioRxiv - Biochemistry 2023Quote: ... The pCR8[mZC3H18] plasmid was used as a template to generate subsequent ZC3H18 cDNA constructs that were cloned into a piggyBAC (pB) vector containing an N-terminal MYC tag and BSD selection marker using NEBbuilder HiFI DNA assembly (NEB). OsTIR1-HA ...
-
bioRxiv - Biochemistry 2023Quote: ... 1% cholorophorm was added together with 10 μg mL-1 DNase 1 (NEB) and 1 μg mL-1 RNase A ...
-
bioRxiv - Biochemistry 2019Quote: ... we used a commercial assay kit (Ph.D.-7 Phage Display Peptide Library Kit, New England Biolabs) and followed the recommended protocol for “solution phase panning with affinity bead capture” with the following modifications ...
-
bioRxiv - Biophysics 2023Quote: ... Plasmid DNA molecules were purified using a commercially available purification kit (MonarchQR Plasmid Miniprep Kit, NEB). The purified plasmids were run on a 0.8% agarose gel supplemented with 2.5 µg/mL of chloroquine in 1xTBE buffer containing 2.5 µg/mL of chloroquine at 25 V for 15 hours ...
-
bioRxiv - Plant Biology 2020Quote: ... using the Gibson assembly kit (NEB). The pET28b vector was linearized by digesting with BamHI and XhoI to create overhangs compatible for Gibson assembly ...
-
bioRxiv - Biophysics 2020Quote: Using PURExpress kits (New England Biolabs), 37.5 μL IVT reactions were assembled on ice with 1.5 μl RNase inhibitor ...
-
bioRxiv - Microbiology 2020Quote: ... using the NEBuilder HiFi kit (NEB).
-
bioRxiv - Microbiology 2020Quote: ... using the NEBuilder HiFi kit (NEB). The mdtU-lacZ translational fusions were constructed by PCR-amplifying the mdtU gene from either a WT (E ...
-
bioRxiv - Molecular Biology 2022Quote: ... NEBNext rRNA Depletion kit( NEB #E7405) was used to deplete ribosomal RNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... USA (NEB PCR Cloning Kit E1203S) were used for the sub-cloning of DNA fragments and to create plasmid templates for run-off in vitro transcription ...
-
bioRxiv - Cell Biology 2019Quote: ... using Gibson assembly cloning kit (NEB). COX8A-SNAP vector was commercially obtained from NEB ...
-
bioRxiv - Genomics 2021Quote: ... NEBNext UltraII Q5 kit (NEB M0544) was used for PCR enrichment ...
-
bioRxiv - Microbiology 2021Quote: ... using Monarch Plasmid Miniprep kit (NEB). Sequencing was through the company Genewiz.
-
bioRxiv - Molecular Biology 2021Quote: ... Q5 Site-Directed Mutagenesis Kit (NEB) was used for generating dCas9 plasmids encoding the mutant p300core* (Y1467F ...
-
bioRxiv - Immunology 2022Quote: ... The second strand synthesis kit (NEB) at 16°C for 2 hours was used for cDNA synthesis followed by a 1.4X AMPure XP bead cleanup ...
-
bioRxiv - Cell Biology 2022Quote: ... Q5 site directed mutagenesis kit (NEB) was used and the manufacturer’s instructions were followed.
-
bioRxiv - Biophysics 2020Quote: ... and Q5 Hotstart Mutatagenesis kit (NEB) were used.
-
bioRxiv - Genomics 2022Quote: Monarch Genomic DNA Purification kit (NEB)
-
bioRxiv - Developmental Biology 2022Quote: ... “Q5 Site-Directed Mutagenesis Kit” (NEB) was used ...
-
bioRxiv - Neuroscience 2020Quote: ... using the Gibson assembly kit (NEB) to create pBPGUw-QF2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... HiScribe T7 ARCA mRNA kit (NEB) was used for mRNA synthesis with 10 μl of 2x ARCA/NTP mix ...
-
bioRxiv - Microbiology 2022Quote: ... or Monarch RNA isolation kit (NEB) was used for RNA extraction ...