Labshake search
Citations for New England Biolabs :
951 - 1000 of 10000+ citations for Glutathione Fluorescent Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... and subsequently 5’-dephosphorylated with Calf intestinal alkaline phosphatase (New England Biolabs). CviAII cuts on a sequence motif ‘CATG’ which is highly frequent on bacterial genomes ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µl of sample was used in PCR with OneTaq polymerase (NEB) with primers Cas168 GGGACAGATACGCGTTTGAT and Cas169 GCCTAACTGAACGGTTTGA as described previously (31) ...
-
bioRxiv - Cell Biology 2021Quote: ... and tumbled with 5 μg of anti-m6A antibody (New England Biolabs) at 4°C overnight ...
-
bioRxiv - Biophysics 2020Quote: ... By replacing dCTP with 5-methyl-dCTP (New England BioLabs, Ipswich, MA) in the nucleotide mix ...
-
bioRxiv - Genomics 2022Quote: ... 5 mM EDTA) supplemented with Proteinase K (New England Biolabs Cat. # P8107S) was added to the beads for both ChIP and input chromatin ...
-
bioRxiv - Molecular Biology 2022Quote: 5’-end 32P-labelled DNA substrates were generated using T4 PNK (NEB) and [ɣ-32P]ATP (PerkinElmer) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’ and 5’ adaptors were ligated by truncated ligase 2 (NEB) and ligase 1 (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... augments Cap-specific 5’ adapter ligation by T4 RNA ligase 1 (NEB)(Hetzel et al. ...
-
bioRxiv - Genetics 2022Quote: ... Eluted cDNA was amplified 5-cycles (NEBNextµltra II Q5 master mix (NEB) with Illumina TruSeq PCR primers RP-1 and RPI-X ...
-
bioRxiv - Molecular Biology 2022Quote: ... Butyryl-Histone H4 (Lys 5) rabbit pAb (PTM Biolabs, SKU: PTM 313), Butyryl-Histone H3 (Lys 27 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and A-tailed using Klenow Fragment (3’→5’ exo-) (New England Biolabs) followed by the ligation of NEXTFLEX® Bisulfite-Seq Adapters ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 U/mL RNase Inhibitor (M0314S; New England Biolabs, Ipswich, MA, USA), EDTA-free protease inhibitor cocktail ...
-
bioRxiv - Microbiology 2020Quote: ... which were then degraded by the 5′-3′ ssDNA exonuclease RecJ (NEB). After rRNA depletion using the Ribo-Zero Gold rRNA removal kit (Illumina) ...
-
bioRxiv - Microbiology 2021Quote: ... Ligations were used to transform NEB 5-alpha competent cells (NEB C2987H) and the cloned spacer was verified by Sanger sequencing using primer PSP108 ...
-
bioRxiv - Microbiology 2021Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs) (0.01 units/μL) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 5 μl of 10X exonuclease I buffer (New England Biolabs B0293S) was then added to each 50 μl reaction to remove unused barcoded primers and incubated at 37°C for 1 hour and then 80°C for 20 minutes ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and 0.5 μl of Klenow DNA polymerase (5 U/μl NEB M0210)) and incubating in a thermocycler with the following program ...
-
bioRxiv - Biochemistry 2022Quote: ... Ea1174 and AncCDT-5(WAG) were expressed in BL21(DE3) cells (NEB): transformed cells were grown in LB media supplemented with 100 mg/L ampicillin to OD600 ∼0.7 at 37°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 μL of ligation products were then transformed into competent cells (NEB). Transformation and plasmid DNA recovery were performed as previously described ...
-
bioRxiv - Systems Biology 2022Quote: ... 5 mM EDTA) + 4 μl of Proteinase K (20 mg/ml, NEB) at 55°C (300 rpm continuous shaking in a thermomixer) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Each IVT product was 5’ capped using Vaccinia Capping Enzyme (NEB-M2080S) following manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2019Quote: ... resuspended in 5 μL of 2X RNA loading dye (New England Biolabs) and heated 5 min at 75° C ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.1 μl Taq DNA Polymerase (NEB, cat#M0273S, 5 U/μl). 10.1 μl of this mastermix was added to each of the 30 μl amplicon pools and incubated for 30 minutes at 20°C followed by 30 minutes at 65°C and finally cooled to 4°C.
-
bioRxiv - Molecular Biology 2021Quote: ... and phosphorylated at the 5’ termini by T4 Polynucleotide Kinase (NEB, M0201L). The pBluescript plasmid was cut by EcoRV and dephosphorylated by Calf Intestinal Alkaline Phosphatase (CIP ...
-
bioRxiv - Genetics 2020Quote: ... Only 1 U/μl I-SceI enzyme 5 X/μl buffer (NEB) were mixed when co-injecting with the HDR donor ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA fragment overhangs are filled with Klenow Fragment (3’-5’ exo-) (NEB) to leave an A-overhang ...
-
bioRxiv - Microbiology 2021Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs) (0.01 units/µL) ...
-
bioRxiv - Microbiology 2021Quote: ... RNA samples were treated with RNA 5’ Pyrophosphohydrolase (RppH) (New England Biolabs) for 30 min at 37°C ...
-
bioRxiv - Physiology 2019Quote: ... such that following digestion (5 units of AvaII (New England BioLabs, R0153) at 37°C ...
-
bioRxiv - Genetics 2020Quote: ... Mutant Csde1 5’UTRs were cloned by Gibson assembly reaction (NEB, E2621S) using mutation containing ssDNA templates with homology arms and two upstream/downstream fragments.
-
bioRxiv - Genomics 2021Quote: ... 5′ adapter ligation with T4 RNA Ligase 1 (NEB, Ipswich, MA; M0204). The 5’ adaptor contained a 6-nucleotide unique molecular identifier (UMI ...
-
bioRxiv - Biochemistry 2021Quote: ... NH4HCO3 (100 mM) and 5 units of alkaline phosphatase (CIP) (NEB, #M0525S) were added and the sample incubated for 2 hours (or 20 min ...
-
bioRxiv - Microbiology 2021Quote: ... Linker-2 (5′-GAGTCTGCGTGTGATTCGGGTTAGGTGTTGGGTTGGGCCA-3′) was ligated using T4 RNA Ligase1 (NEB). Reaction mixtures were resolved on a 10% TBE-Urea gel ...
-
bioRxiv - Genomics 2021Quote: Purified RNA (5 ug) was reverse transcribed using Random Primer 9 (NEB) and SuperScript II reverse transcriptase under error prone conditions as described Smola et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... transformed into NEB 5-alpha chemically competent Escherichia coli (New England BioLabs), and submitted for Sanger sequencing (Eurofins Genomics ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was transformed into NEB 5-alpha high efficiency competent cells (NEB). Insert size was verified with PCR and purified plasmids were sequenced using Sanger sequencing.
-
bioRxiv - Microbiology 2020Quote: ... 5 μL 2x NEBnext High-Fidelity PCR Master Mix (New England Biolabs) and 2.9 μL nuclease-free distilled H2O (ThermoFisher Scientific) ...
-
bioRxiv - Genomics 2022Quote: ... 5′ adapter ligation with T4 RNA Ligase 1 (NEB, Ipswich, MA; M0204). The 5’ adaptor contained a 6-nucleotide unique molecular identifier (UMI ...
-
bioRxiv - Genomics 2022Quote: ... The 5’ end of the transcript was phosphorylated using PNK (NEB M0201L) and then purified with Trizol (Life Technologies 15596-026) ...
-
bioRxiv - Microbiology 2022Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs) (0.01 units/µL) ...
-
bioRxiv - Systems Biology 2023Quote: ... The second strand was synthesized using Klenow Fragment (3’ → 5’ exo-) (NEB). The dsDNA library was digested with Mlul-HF and Pad restriction enzymes (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... 20 μL NEBNext 5× Quick Ligation Reaction Buffer (New England Biolabs, UK), and 10 μL of Quick T4 DNA Ligase ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 μL of 800 U/mL proteinase K (New England Biolabs) was added ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 μL of ligation product was then transformed into competent cells (NEB). Transformation and plasmid DNA recovery were performed as previously described ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 μg purified DNA was digested overnight with HinfI and HaeIII (NEB) at 37°C and resolved on a 1% agarose gel ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 μg of total RNA were treated with DNase and CIP (NEB) to remove DNA and all non-capped RNA ...
-
bioRxiv - Biochemistry 2024Quote: ... 5’-end radiolabeled DNA was generated with T4 polynucleotide kinase (M0201L, NEB) and [γ-32P]ATP (NEG035C005MC ...
-
bioRxiv - Cell Biology 2023Quote: ... phosphorylated at 5’-termini by T4 Polynucleotide Kinase (M0201, New England Biolabs) and ligated using T4 DNA Ligase (M0202 ...
-
bioRxiv - Biochemistry 2024Quote: ... Parental plasmids were digested by adding 5 µL 10x cutsmart buffer (NEB), and 1 µL DpnI (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA substrates were 5’ terminally labelled with T4 Polynucleotide Kinase (NEB, M0201S) and ATP-γ-32P (PerkinElmer ...