Labshake search
Citations for New England Biolabs :
951 - 1000 of 4857 citations for 5 3 Chloro 4 2 cyclohexylethoxy phenyl methylene 2 4 thiazolidinedione d4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... and 2 units of Phusion High-Fidelity DNA Polymerase (NEB) in HF Phusion buffer ...
-
bioRxiv - Plant Biology 2022Quote: ... 1mM DTT) and treated with 2 units of CIP (NEB) at 37°C for 15mins ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 units of Phusion High-Fidelity DNA Polymerase (NEB) in 1X Phusion HF buffer to a total volume of 100 µL ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 μl 10× Template Switching RT Enzyme Mix (NEB) were added to the mixture and the reaction was incubated at 42 °C for 90 min followed by 85 °C for 5 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 μL of DNA polymerase I (10 U/μL, NEB) and 0.5 μL RNase H (2 U/μL ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 mM ribonucleoside-vanadyl complex (New England Biolabs, # S1402S)) ...
-
bioRxiv - Genomics 2024Quote: The reaction is supplemented with 2 μl Exonuclease V (NEB) and 5 μl of ATP 10 mM ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 μl of T4 RNA ligase (New England Biolabs) and mixed ...
-
bioRxiv - Immunology 2023Quote: ... 2 mM ribonucleoside vanadyl complex (New England Biolabs, Ipswich, MA), 0.02% RNase free bovine serum albumin (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... 2 μL of Monarch RNase A (New England Biolabs (NEB)) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 0.62 µL of 2 mg/mL BSA (NEB #B9001S) with the following thermal cycle condition ...
-
bioRxiv - Bioengineering 2023Quote: ... Q5® High-Fidelity 2×Master Mix (New England Biolabs) was used in all the PCR reactions ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM Vanadyl Ribonucleoside Complex (Cat: S1402S; New England Biolabs), and 10 U/mL SUPERase•In RNase Inhibitor (Cat ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μL of peptide N-glycosidase F (New England Biolabs) were added ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 U/µl T4 RNA Ligase 2 truncated KQ (NEB), 2 µM HDVLig (pre-adenylated using a 5’ adenylation kit (NEB)) ...
-
bioRxiv - Genomics 2023Quote: ... using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541S). The 2nd round PCR mixture was prepared and purified similarly to the 1st ...
-
bioRxiv - Biochemistry 2022Quote: ... were expressed in Rosetta 2 (DE3) pLysS competent cells (NEB) grown in modified Terrific Broth at 27°C for 7 hours ...
-
bioRxiv - Genomics 2023Quote: ... 2 μL of Monarch RNase A (New England Biolabs (NEB)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 2 U/mL DNase I (New England Biolabs, M0303L). Cells were passed through a 40 µm mash and seeded at high density in BME.
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 μl Bst 2 WarmStart DNA polymerase (NEB M0538S) was added and sample incubated 30 min at 65°C before precipitation with 12.5 μl 10 M NH4OAc ...
-
bioRxiv - Genomics 2023Quote: ... The APOBEC reaction mix (2 μL APOBEC reaction buffer (NEB), 0.2 μL APOBEC (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... The APOBEC reaction mix (2 μL APOBEC reaction buffer (NEB), 0.4 μL APOBEC (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... (2) +28 μl Dam at 8 U/μl (NEB M0222L); (3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 U of DNase I-XT (New England Biolabs, USA) was added into 10 μL of reaction mixture and incubation was extended for 30 min at 37°C to remove the DNA templates ...
-
Emergence of RNA-guided transcription factors via domestication of transposon-encoded TnpB nucleasesbioRxiv - Genetics 2023Quote: ... and samples were then individually diluted in NEBuffer 2 (NEB) and fragmented by incubating at 92 °C for 1.5 min ...
-
bioRxiv - Microbiology 2024Quote: ... lysates were treated with 2 units of Proteinase K (NEB) for 30min ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µl T7 RNA Polymerase (New England BioLabs, Ipswich, MA), 5 µl ATP (10 μmol) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 µl of RNase H Buffer (New England Biolabs) was added and incubated at 45°C for 30 min ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Cas12a RNP: (13 µl water; 2 µl r2.1 buffer [NEB, Cat ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 2 units of Phusion High-Fidelity DNA Polymerase (NEB) in HF Phusion buffer ...
-
bioRxiv - Systems Biology 2024Quote: ... and 1 μL of Phusion Polymerase (2 U/μL, NEB) were added and mixed by pipette ...
-
bioRxiv - Systems Biology 2024Quote: ... and 2 μL of DNA Polymerase I (10U/μL, NEB) were added and mixed by pipetting ...
-
bioRxiv - Systems Biology 2024Quote: ... and 2 μL of T4 PNK (10 U/μL, NEB) were added ...
-
High-resolution profiling reveals coupled transcriptional and translational regulation of transgenesbioRxiv - Synthetic Biology 2024Quote: ... treated with 2 µL DNase I (New England Biolabs, M0303), and incubated at 37°C for 30 min to degrade the IVT PCR template DNA ...
-
bioRxiv - Microbiology 2024Quote: ... burgdorferi cells using QuickLoad 2× Taq Master Mix (NEB, M0271). Positive clones were flash frozen on dry ice in BSK-II containing 10% DMSO (Sigma ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 2 µL of 20 µM SpCas9 (New England Biolabs M0646T) were gently mixed with 2 µL of 100 µM gRNA ...
-
bioRxiv - Genomics 2024Quote: ... was added to the gDNA in 1x NEBuffer 2 (NEB) in a final volume of 25 µL and incubated for 30-min at 37°C ...
-
bioRxiv - Genetics 2024Quote: ... 2 μL of T4 Ligase buffer (New England Biolabs, USA) and 1 μL of T4 Polynucleotide Kinase (10 U/μL ...
-
bioRxiv - Biophysics 2024Quote: ... before annealing and ligated using T4 RNA ligase 2 (NEB). Constructs containing 30 nt gaps ...
-
bioRxiv - Genomics 2024Quote: ... and 50 μL of NEBNext 2× Master Mix (NEB M0541S). oGH840.1-6 are six oligonucleotides with variable lengths to stagger and phase the sequencing of a common sequence in the target site amplicon ...
-
bioRxiv - Genetics 2024Quote: ... and digested with 2 μl of β-agarase I (NEB) at 42 °C for 90 min ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 units of either DNase I or T7 Exonuclease (NEB) were then added ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 μL of T4 DNA ligase (NEB, 400000 U/mL), and 4 μL of 10X T4 DNA ligase buffer (NEB) ...
-
bioRxiv - Genetics 2024Quote: ... using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541S). We inserted these three fragments into the pLS-SceI plasmid (Addgene ...
-
bioRxiv - Developmental Biology 2024Quote: ... together with 2 µM of Cas9 protein (NEB, Cat# M0646T). Tol2-plasmids were diluted in 0.05% Phenol red to a final concentration of 100 ng/µL ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 3’ adenine overhangs were added to the blunt-end DNA fragments by Klenow Fragment (3’-5’ exo; NEB; Cat. No. M0212L). The DNA fragments were then ligated with diversity-increased custom barcodes (Shi et al. ...
-
bioRxiv - Microbiology 2022Quote: ... and we amplified mEmerald including vector sequence but omitting the mitochondrial targeting sequence from the mEmerald-Mito-7 plasmid using primers mEmeraldVector forward (5’ TGGATCCATGGGGGATCCACCGGTCGCC 3’) and mEmeraldVector reverse (5’ ACACCGACATGCTAGCGGATCTGACGGTTCAC 3’) and combined the fragments using a HiFi assembly kit (New England Biolabs, Ipswich, MA) to create a plasmid expressing CHMP4B-mEmerald ...
-
bioRxiv - Biochemistry 2023Quote: ... primers “frq segment 2F” (5’-GTGAGTTGGAGGCAACGCTC-3’) and “frq segment 2R” (5’-GTCCATATTCTCGGATGGTA-3’ were used for PCRs in combination with pCB05 digested with XhoI (NEB, Catalog # R0146S) to NruI (NEB ...
-
bioRxiv - Genetics 2023Quote: ... PCR-derived DNA fragments were generated by pairing oWS1359 (5°-TATGATTCCGATGAAGAAGAACAAGGTGGCGAAGGTGTACAATGT-iTriMix20-iTriMix20-iTriMix20-TGATTTTCTTGATAAAAAAAGATC-3°) and oWS1308 (5°-CAGCATATAATCCCTGCTTTA-3°) and pWS1728 template using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA). The PCR products were purified (Omega E.Z.N.A Cycle Pure kit ...
-
bioRxiv - Genomics 2021Quote: ... DNA samples were incubated with 50 μM dATP and 5 U of Klenow Fragment (3’→5’ exo-) (New England Biolabs, M0212) in 30 μl 1 × NEBuffer2 at 37°C for 30 minutes.