Labshake search
Citations for New England Biolabs :
951 - 1000 of 3392 citations for 3RS 4 Dimethylamino 3 methyl 2 2 diphenylbutanenitrile Isodidiavalo since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... a fragment including the SARS-CoV-2 RdRp catalytic residue was subcloned into pUC19 (NEB) and the resulting pUC19-RdRp was mutated at the RdRp catalytic residue by inverse PCR using mutation-introducing primers (Supplementary Table 1) ...
-
bioRxiv - Microbiology 2022Quote: ... and library preparation was performed using the NEBNext ARTIC SARS-CoV-2 FS kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... PCR amplicons encompassing exon 2 of SERINC3 were produced using Taq 2x Master Mix (NEB) and the following primers ...
-
bioRxiv - Bioengineering 2024Quote: ... 2) parts were either synthesized as fragments (Twist Bioscience) and subsequently PCRed using Q5 (NEB), or synthesized as duplex oligos (IDT) ...
-
bioRxiv - Cell Biology 2024Quote: ... RNF43 mutants were generated by PCR-subcloning using Q5 High-Fidelity 2× Master Mix (NEB). Domain swapped constructs were generated by in-fusion cloning (Takara Bio) ...
-
bioRxiv - Immunology 2024Quote: ... Purified round 2 PCR products were cloned using the NEB PCR Cloning Kit (NEB, #E1202) and sequenced with Sanger sequencing.
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: ... Samples were cooled to 42 °C and 2 μl of β-agarase I enzyme (NEB) was added and incubated at 42 °C for 90 min with occasional vortexing ...
-
bioRxiv - Biochemistry 2023Quote: ... Total RNA (2 µg) was first annealed with 200 ng random nonamer primers (NEB S1254S) by incubation at 70°C for 5 min ...
-
bioRxiv - Cell Biology 2023Quote: ... The cutting vector GW223_pX330A_sgX_sgPITCh (2 μg) was digested with BbsI-HF (New England Biolabs; #R3539) in Cutsmart Buffer (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... For AsiSI digestion, samples were equilibrated (2 min, RT) in 150 µL CutSmart buffer (NEB). 3µl recombinant AsiSI endonuclease (10U/µL ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μL of each ATAC-seq library was added to 2x NEBNext Master Mix (NEB) and 0.4x SYBR Green (Thermo Fisher ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR reactions were performed by combining 12.5 µL Q5 high-fidelity 2× master mix (NEB), 2.5 µL each of 10 µM forward and reverse primers ...
-
bioRxiv - Genomics 2022Quote: ... were enriched from total RNA using the SARS-CoV-2 / TBRV MagIC beads (ElementZero Biolabs) according to the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2023Quote: ... PCR amplified Domain 1 and PCR Domain 2 and HiFi DNA assmbley was performed (NEB). Transformation was performed in DH5α cells (REF) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μg of gRNA was mixed with 3.3 μL of Spy Cas9 NLS (NEB, UK) and incubated for 30 min at RT ...
-
bioRxiv - Immunology 2023Quote: ... After digestion the linearized backbone was dephosphorylated by addition of 2 µl rSAP (NEB, #M0371S) and incubation at 37 °C for 1 hour followed by heat inactivation of the enzymes at 80 °C for 20 minutes ...
-
bioRxiv - Systems Biology 2023Quote: ... 2) the CYC terminator by digesting pDL00212 with HindIII-HF (New England Biolabs, Ipswitch, MA) and SpeI-HF (New England Biolabs ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 µg of DNA was treated with uracil DNA glycosylase (UDG, New England Biolabs, Inc.) for 60 minutes at 37°C with gentle shaking ...
-
bioRxiv - Microbiology 2024Quote: ... 9.5 µL of tRNA was combined with 2 U/µL of T4 PNK (NEB, M0201S) was well as N-terminally His6-TEV-tagged ATfaRel SAH (final concentration 1 µM ...
-
bioRxiv - Developmental Biology 2024Quote: 2 μg of genomic DNA was digested with 100 units of Taq1-v2 (NEB R0149S) and 100 μg of RNaseA overnight ...
-
bioRxiv - Microbiology 2024Quote: ... with NEBNext® Multiplex Oligos for Illumina Dual Index Primers Sets 1 and 2 (NEB). Manufacturer’s instructions were followed except the post-ligation bead clean-up ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing libraries were prepared using the NEBNext ARTIC SARS-CoV-2 Library Prep Kit (NEB) and ARTIC V5.3.2 primer sets ...
-
bioRxiv - Molecular Biology 2024Quote: ... 8.8 µL of the probed RNA were combined with 2 µL 10 mM dNTPs (NEB) and 1 µL 200 ng/µL random nonamer (Random Primer 9 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 20 mM MgCl2) prior to addition of 20 units (2 µl) NruI (New England Biolabs). The restriction digests were carried out at 37 ◦C for 2 hours ...
-
bioRxiv - Immunology 2024Quote: ... Sequence libraries were amplified using NEBNext High Fidelity 2× PCR Master Mix (New England Biolabs) and barcoded primers ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 1-2 µg phi47 DNA was treated with Nucleoside Digestion Mix (New England Biolabs) following the manufacturer’s protocol at 37°C for >2h ...
-
bioRxiv - Molecular Biology 2024Quote: ... the digested nuclei were proximally ligated with 2 μl of T4 DNA ligase (NEB M0202S) at room temperature for 4 h ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was coated with 25 µL/well of 2 µg/µL streptavidin (New England Biolabs; N7021S) diluted in 1x HBS and incubated overnight at 4 °C ...
-
bioRxiv - Genomics 2024Quote: ... 100-500 ng of genomic DNA was fragmented using 2 units of Nt.CviPII (NEB # R0626S) in 500 µl of 1X NEBuffer 2 at 37°C for 4 hrs to overnight ...
-
bioRxiv - Genomics 2024Quote: ... were prepared using the Q5 Hot Start High-Fidelity 2 × Master Mix (Cat# M0494L, NEB) as follows ...
-
bioRxiv - Bioengineering 2024Quote: ... A molecular weight ladder was prepared using 2 µL of ssRNA ladder (New England Biolabs), 8 µL of RNase-free water (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Genomics 2022Quote: ... Enzymatic conversion was then performed using the NEBNext Enzymatic Methyl-seq Conversion Module (New England Biolabs, Cat. E7125L) following manufacturers protocol (steps 1.5 to 1.9.11 ...
-
bioRxiv - Genomics 2024Quote: ... 200 ng of sheared DNA was processed using the NEBNext Enzymatic Methyl-seq Kit (E7120; NEB, Ipswich, MA) following the manufacturer’s instructions for large insert libraries ...
-
bioRxiv - Genomics 2024Quote: ... Barcoded libraries were TET-treated following an abbreviated protocol for NEBNext Enzymatic Methyl-Seq Conversion Module (NEB, #E7120) to enzymatically convert modified cytosines into 5-carboxylcytosine ...
-
bioRxiv - Genomics 2024Quote: ... Barcoded libraries were TET-treated following an abbreviated protocol for NEBNext Enzymatic Methyl-Seq Conversion Module (NEB, #E7120) to enzymatically convert modified cytosines into 5-carboxylcytosine ...
-
bioRxiv - Biophysics 2021Quote: ... the SNAP-tag fragment was digested from the pSNAP-tag (T7)-2 vector (New England Biolabs), inserted into pET-28b plasmid resulting in a construct referred as pET-SNAP ...
-
bioRxiv - Cell Biology 2020Quote: ... and 2) the insert and pcDNA5-FRT-TO were digested with 40U of EcoRV-HF (NEB) and 40U of XhoI (NEB).
-
bioRxiv - Cell Biology 2020Quote: ... peak fractions pooled and reacted with 2-molar excess SNAP-substrate Alexa-488 dye (S9129, NEB) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The nuclei were harvested and resuspended in 0.5ml cold 1.2x NEB Buffer 2 (New England Biolabs), incubated with 0.3% SDS for 1 hr at 37°C ...
-
bioRxiv - Genomics 2022Quote: ... 10 μl 2X Quick T4 ligase buffer and 2 μl Quick T4 DNA ligase (NEB, M2200L) were added to the reaction and incubate at 37 °C for overnight ...
-
bioRxiv - Genomics 2020Quote: ... 66U/μl truncated T4 ligase 2 and 13U/μl murine RNAse inhibitor (all from NEB, USA)) were added to the aRNA/adapter solution ...
-
bioRxiv - Developmental Biology 2021Quote: ... 10 µl of PCR product was then mixed with 1.5 µl 10X NEBuffer 2 (B7002S, NEB) and 1.5 µl of Nuclease-free water ...
-
bioRxiv - Biochemistry 2021Quote: ... This was added to 5 ml (per 2 L of culture) amylose resin (New England Biolabs) equilibrated in lysis buffer and left on a tube roller shaker at 4 °C for 1 h ...
-
bioRxiv - Plant Biology 2021Quote: ... using BamHI and XhoI restriction sites and 2× Gibson Assembly master mix (NEB, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.4 units μL−1 T7 RNA polymerase (RNAP, NEB 2 units μL−1 RNase inhibitor (NEB), 50 nM Cas9 (NEB) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.4 units μL−1 T7 RNA polymerase (RNAP, NEB 2 units μL−1 RNase inhibitor (NEB), 50 nM Cas9 (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... For reverse transcription (RT) 1 µg RNA was digested with 2 U of DNase I (NEB). After heat inactivation of the DNase at 70 °C for 5 min ...