Labshake search
Citations for New England Biolabs :
951 - 1000 of 3716 citations for 3 hydroxy 20 oxopregn 5 en 21 yl acetate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... followed by addition of 20 µl of Proteinase K (NEB) and another incubation at 65°C overnight ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was incubated with 20 ml amylose resin (NEB) pre-equilibrated with lysis buffer for 15 mins before loading onto a gravity flow column ...
-
bioRxiv - Microbiology 2022Quote: ... 20 U of RNase murine inhibitor (NEB, Ipswich, MA, USA), 0.15 µL Cas13a endonuclease (25 nM ...
-
bioRxiv - Genomics 2022Quote: ... 1% bovine serum albumin (BSA) solution (NEB, 20 mg/mL). Nuclei were pelleted at 600 RCF for 5 minutes at 4C ...
-
bioRxiv - Genomics 2022Quote: ... and resolved on a 4–20% SDS-polyacrylamide gel (NEB). The presence of MeCP2 was assayed by western blotting using anti-MeCP2 monoclonal antibody M6818 (Sigma ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 µL NEBNext Quick Ligation Reaction Buffer 5X (NEB, B6058S) and 10 µL Quick T4 DNA Ligase (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... 20 µL NEBNext Quick Ligation Reaction Buffer 5X (NEB, B6058S) and 10 µL Quick T4 DNA Ligase (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... 10 µl of proteinase-K (NEB, stock 20 mg/ml) was added and incubated at 37 ℃ for 1 h ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 2 µL of 20 µM SpCas9 (New England Biolabs M0646T) were gently mixed with 2 µL of 100 µM gRNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... The total RNA (20 μg) was subjected to DNaseI (NEB) digestion for 40 minutes as per manufacturer protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... and 20 U of Bsal-HF v2 (New England Biolabs), incubated at 37 °C for 16 h to drive the reaction ...
-
bioRxiv - Genetics 2024Quote: ... 20 µl RNAse A (10 mg/ml, New England Biolabs) were added and the solution incubated for 1 hour at 37 °C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3’ deoxy-adenine overhangs were added using Klenow Fragment (NEB), the sample was purified with QIAquick column ...
-
bioRxiv - Genomics 2020Quote: ... 1 μl (3 U/μl) of T4 DNA polymerase (NEB), 1 μl (10 U/μl ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reactions contained 3 µL of BSA (New England Biosciences (NEB), Ipswich ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 μl AnP stock (5,000 units/ml, New England Biolabs) was added to 50 μM purified CST in Buffer A along with 0.5 mM ZnCl2 and 1mM MgCl2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.5 μl of 3’Ligation Enzyme Mix (NEB-kit) were added and incubated for 18 h at 16°C over-night ...
-
bioRxiv - Microbiology 2022Quote: ... and 0.17 μL of random primers (3 mg/mL NEB) in a total volume of 5.25 μL ...
-
bioRxiv - Genomics 2020Quote: ... 3 mM DTT 8 μl Large Klenow Fragment (NEB, #M0210L) and 2 μl T4 PNK (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... gDNA (3 μg) was digested by HpaII (New England Biolabs) at 37°C for 1 hr ...
-
bioRxiv - Biochemistry 2021Quote: ... and 40 U of β1-3 Galactosidase (New England Biolabs) for 16 h at 37°C.
-
bioRxiv - Molecular Biology 2020Quote: ... RNA (3 μg) was treated with DNase (New England Biolabs) and reverse transcribed using random primer mix (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 µL Ultra II End-prep enzyme mix (NEB, E76468). The mixture was incubated at 20 °C for 5 minutes and 65 °C for 5 minutes ...
-
bioRxiv - Genomics 2024Quote: ... followed by 3′ adapter ligation using T4 RNA ligase (NEB). Biotinylated RNAs were enriched for a second time ...
-
bioRxiv - Microbiology 2024Quote: ... and 3 µl Ultra II end prep enzyme mix (NEB), and incubated at 20 °C for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA 3’ ends were dephosphorylated using T4 PNK (NEB, M0201). DNA ends were then blunted using T4 DNA polymerase (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... 3 μL containing 0.01 U Bst 2.0 DNA polymerases (NEB), 0.5 U SplintR ligase (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... The APOBEC reaction mix (3 μL APOBEC reaction buffer (NEB), 0.3 μL APOBEC (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... 3 μL NEBNext Ultra II End Prep Enzyme Mix (NEB), and nuclease-free water (NFW) ...
-
bioRxiv - Genomics 2023Quote: ... 3 uL of 10x T4 ligase buffer (New England Biolabs), 75 ng destination vector ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2-3 ×106 cells were treated with MNase (NEB M0247) ranging from 10-30 Kunitz U in 800 μl of custom buffer (Tris-HCl pH 7.5 10 mM ...
-
bioRxiv - Genetics 2023Quote: ... 1 μl T4 PNK (3′ phosphatase minus, New England BioLabs)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... A-tailing by Klenow Fragment (3’è5’ exo-; NEB M0212S), and TruSeq 6-bp index adaptor ligation by Quick ligase (NEB M2200S) ...
-
bioRxiv - Cell Biology 2024Quote: ... and the RNAs were 3’end dephosphorylated by PNK (NEB) and FastAP phosphatases (Thermo) ...
-
bioRxiv - Genomics 2024Quote: ... The 3 library pools were purified by an ExoSAPII (NEB) reaction to remove single-stranded DNA and further by column purification (MiniElute Gel Extraction Kit ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 µL Ultra II End-prep enzyme mix (NEB, E76468). The mixture was incubated at 20 °C for 5 minutes and 65 °C for 5 minutes ...
-
bioRxiv - Genomics 2024Quote: ... 3 µL H2O and Therminator IX (NEB 10 U/µL) to the sample ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 μL of T4 DNA Polymerase (3 U/μL, NEB) 1 μL of Klenow DNA Polymerase (5 U/μL ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by 3’ A-tailing by Klenow exo (NEB, M0212L) and adaptor ligation using T4 DNA ligase (NEB ...
-
bioRxiv - Genetics 2024Quote: ... 3 μL of 10x T4 ligase buffer (New England Biolabs), 75 ng destination vector ...
-
bioRxiv - Genetics 2022Quote: ... 5 µL of each reaction was combined with 5 µL Phusion Hot Start Flex 2x Master Mix (NEB) and sequences were extended (95 °C 3 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5′-preadenylated oligos oHR546-551 were then ligated to the cDNA using 5′ App DNA/RNA ligase (NEB). Amplification and barcoding PCR was then performed with oligos that annealed to the TSA5 and TSA7 sequences and added i5/i7 and P5/P7 sequences ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM DTT) and the 5’-ends were phosphorylated with 25 units of T4 Polynucleotide Kinase (NEB #M0201) for 15 min at 37 °C while shaking in a thermomixer at 1000 rpm for an interval of 15 sec every 3 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... Dephosphorylation of the 5’-triphosphate pre-tRNA was done using 5 units QuickCIP (New England Biolabs, cat#M0525S) for 30 minutes at 37°C in 1X rCutSmart Buffer (New England Biolabs ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR amplification (primers 5’ GCTTGATTTAGGTGACACTATAGAATAC, 5’ ACTCCCGGGTTAAGCGGTACGGTTGTACAGG) was performed using Phusion High Fidelity DNA polymerase (New England Biolabs) using pCS2 TeNT-LC-GFP as a template (a gift from Martin Meyer) ...
-
bioRxiv - Genomics 2024Quote: ... Nuclei were digested using 800 U of BamHI (for 5’-5’ loop) or BglII (for junction loop) (NEB) on a shaker overnight at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 7.5 µl m7G(5′)ppp(5′)G RNA Cap Structure Analog (10 μmol) (New England BioLabs, Ipswich, MA), 2 µg linearized DNA ...
-
bioRxiv - Molecular Biology 2024Quote: A 2-fold excess of either m7G(5’)ppp(5’)G RNA Cap Structure Analog (New England Biolabs) or chemically synthesized cap4 hexa-nucleotide (see cap4 synthesis below ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... .5 uL of Phusion polymerase (NEB M0530S), and enough to water to total the reaction volume at 50 uL ...
-
bioRxiv - Bioengineering 2022Quote: ... 5 μL of 5x Phusion buffer (NEB) and 14.25 μL of nuclease-free water ...