Labshake search
Citations for New England Biolabs :
951 - 1000 of 7694 citations for 2R 5S 5 4 amino 5 fluoro 2 oxopyrimidin 1 2H yl 1 3 oxathiolan 2 yl methyl butyrate WXC04778 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2020Quote: ... at 65⁰C for 2h followed by MspI (NEB R0106) at 37⁰C overnight ...
-
bioRxiv - Immunology 2021Quote: ... Samples were added to second-strand synthesis mix containing 2× NEB buffer 2 (NEB), 625 nM dNTP Mixture (NEB) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 50 ng PCR product was incubated with 2 µL 10X NEBuffer 2 (NEB, B7002S) and nuclease-free water adding up to 19 µL using the following program ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were expressed and purified from 2 to 4 liters of Escherichia coli NiCo21(DE3) (New England Biolabs) as previously described (24) ...
-
bioRxiv - Molecular Biology 2021Quote: An RNA oligonucleotide (5’-GGCATGTGATTGGTGGGTC) was 5’ labelled with gamma 32P ATP by T4 Polynucleotide Kinase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... 5% CO2 -balanced complete cell culture medium with 5 μM SNAP-Surface Alexa Fluor 647 (NEB, S9136S), for 15 minutes at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... or 120 μM m7G(5’)ppp(5’)G RNA Cap Structure Analog (M7; New England BioLabs #S1404S) was used ...
-
bioRxiv - Genomics 2024Quote: ... the 5’-end of nascent RNAs was decapped on-beads in RNA 5’ Pyrophosphorylase mix (NEB, M0356S) at 37 °C for 45 min ...
-
bioRxiv - Synthetic Biology 2024Quote: G(5’)ppp(5’)A RNA Cap Structure Analog (New England Biolabs Japan Inc., Tokyo, Japan, #S1406)
-
bioRxiv - Microbiology 2024Quote: ... the RNA was ligated to the 5′-universal RNA adapter (5′GAUAUGCGCGAAUUCCUGUAGAACGAACACUAGAAGAAA3′) using T4 RNA ligase (NEB). After extraction with 25:24:1 phenol/chloroform/isoamyl alcohol and ethanol precipitation ...
-
bioRxiv - Bioengineering 2023Quote: ... and assembled with PCR amplified (primers 2 and 3) pRSET vector fragment using Gibson assembly (NEB Japan, Tokyo, Japan) to add T7 promoter ...
-
bioRxiv - Evolutionary Biology 2021Quote: 5’ phosphorylation was performed by mixing 6 uL of rRNA depleted RNA with 1 uL of 10X PNK buffer (NEB B0201S), 1 uL of PNK enzyme (NEB M0236S) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Adaptor ligated RNAs 48-58nt long (corresponding to 19-29nt long input RNAs) were extracted and ligated to the 5’ adaptor using T4 RNA Ligase 1 (NEB, M0204). A total of ten variable nucleotides (unique molecular identifiers ...
-
bioRxiv - Genomics 2021Quote: ... 0.5 µg of the treated RNA was used for ligation to an RNA oligonucleotide with T4 RNA ligase 1 (NEB M0204) for 1 hr at 25 °C then converted to first strand cDNA with random priming and the ProtoScript II reverse transcriptase mix (NEB E6560) ...
-
bioRxiv - Systems Biology 2020Quote: ... 10 mM DTT, 12% PEG 8000, 1 mM each dNTPs, 10 µM dN-SMRT oligo, 5 µl Klenow enzyme NEB #M0212) for 1 h at 37 °C ...
-
bioRxiv - Genomics 2022Quote: ... Biotin-labeled DNA fragments captured on beads were ligated to multiplexing adaptors by adding 5 μL each adapter (50 μM) and 1 μL T7 DNA ligase (NEB, M0318L) in 100 μL ligation mixture and incubating at room temperature for 1 hour with rotation ...
-
bioRxiv - Biochemistry 2021Quote: ... at 37 °C for 1 hour or first with 5 units T4 Polynucleotide Kinase with 25 mM ATP in 1 X T4 Kinase buffer (T4PNK, NEB, M0236S) at 37 °C for 30 min and then with XRN-1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 5’ ends of RNA fragments were phosphorylated by T4 PNK and ligated to 5’ adaptor (CGATCTCCAATTCCCACTCCTTTCAAGACCTrC) using T4 RNA Ligase 1 (NEB, M0437M). Ribosomal RNA (rRNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1/20th of the annealed substrates was 5′-end-labelled with [γ-32P]-ATP and T4 polynucleotide kinase (New England Biolabs). For fluorescently labeled HJ40 substrates ...
-
bioRxiv - Plant Biology 2023Quote: ... 500 ng of RCA amplicons were treated with T7 endonuclease 5 μL of 10× reaction buffer and 1 μL of T7 endonuclease I (New England Biolabs, M0302S) in a 50 μL reaction volume ...
-
bioRxiv - Immunology 2023Quote: ... The digested and purified inset and vector were ligated at a ratio of 5:1 using T4 DNA ligase (NEB, M0202) overnight at 18°C ...
-
bioRxiv - Genomics 2023Quote: ... The pellet was resuspended in 90 µL of freshly prepared Micro-C “Master Mix 1” (10 μl 10x T4 DNA Ligase Buffer, 75 μl ddH2O, 5 μl T4 PNK (NEB #M0201L)) ...
-
bioRxiv - Biochemistry 2024Quote: ... Samples were diluted at a 1:5 ratio with H2O prior to qPCR using Luna Universal qPCR Master Mix (New England Biolabs, #M3003) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 units DNase I (NEB), or both for 30 min at 37 °C ...
-
bioRxiv - Immunology 2021Quote: ... α2-3,6,8,9 neuraminidase A (NEB), LB Broth (BD Difco™) ...
-
bioRxiv - Microbiology 2020Quote: ... 2) NEB Q5 (NEB M0491), 3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... T4 RNA ligase 2 (NEB) and RiboLock RNase inhibitor (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... 2 U DNase I (NEB) was added to IVT mixture and further incubated at 37 °C for 30 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 units DNase I (NEB), or both for 1 h at 37°C and resolved on a denaturing urea polyacrylamide gel (20% ...
-
bioRxiv - Microbiology 2021Quote: ... in 1x NEBuffer 2 (NEB) at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl Proteinase K (NEB) was added and samples were incubated at 56°C for 1 hour ...
-
bioRxiv - Biophysics 2022Quote: ... 2 µL factor mix (NEB), 250 nM pre-incubated 50S subunit ...
-
bioRxiv - Genomics 2024Quote: ... 2 μl of BSA (NEB), 15 μl of dNTPs 10 mM ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 μL ATP (NEB, B0202S), 2 μL 10X restriction digest buffer (Thermo Scientific ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and set 2 (NEB #7500S) according to the manufacturer’s protocol with minor modifications as noted below ...
-
bioRxiv - Developmental Biology 2023Quote: ... and Set 2 (E7500S, NEB). Quality of the final library preparation was analysed on the Bioanalyzer using the High Sensitivity DNA reagents kit and cassettes (5067-4626 ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2 mM ATP) (NEB) at 30 °C for 1 h ...
-
bioRxiv - Immunology 2022Quote: ... with 2 mM MgCl2 (NEB), 0.2mM dNTPs (made in house) ...
-
bioRxiv - Genetics 2024Quote: ... 2 μl of DpnII (NEB) was added to digest the chromatin overnight at 37 °C with shaking at 900 rpm and deactivated at 65 °C for 20 min.
-
bioRxiv - Physiology 2024Quote: ... with 1x GlycoBuffer 2 (NEB), 5 μL of O-glycosidase (40,000 U/μL ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10X NEB buffer 2 (NEB) was added to 200 ng DNA and PCR products were denatured to single strands by heating at 95°C for 5 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... 2 U RNase H (NEB) was added to hydrolyze the RNA at 37°C for 15 min ...
-
bioRxiv - Genomics 2024Quote: ... 0.5 µL NEBuffer 2 (NEB), 2.8 µL H2O and 0.2 µL Therminator IX (NEB ...
-
bioRxiv - Genomics 2024Quote: ... in 1x NEBuffer 2 (NEB) in a final volume of 10 µL ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 µL T4 ligase (NEB), 4 µL 10x T4 ligase buffer (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... Index Primers Sets 3 and 4 (New England Biolabs). Libraries were sequenced on an Ilumina NextSeq500 ...
-
bioRxiv - Biochemistry 2023Quote: ... The duplex hRNase 4 cleavage products (5′ fragments of the RNA) were enriched using Hydrophilic Streptavidin Magnetic Beads (New England Biolabs). The beads were washed twice by a high salt buffer (5 mM Tris HCl ...
-
bioRxiv - Neuroscience 2024Quote: ... slides were rinsed three times with deionized water for 5 minutes and incubated in 1x Terminal Transferase (TdT) buffer containing 1X buffer 4 (NEB) and 2.5 μM CoCL2 for 10 minutes at room temperature in a humid chamber ...
-
bioRxiv - Molecular Biology 2020Quote: ... then blunted overnight at 37°C in 100 μl NEBuffer 2 with 0.1 mM dNTPs and 1 μl Klenow (NEB M0210S). After rinsing twice with 1 ml tris buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... the nonstop GFP1-10 sequence was produced by PCR using primers #1 and 2 and Q5 High-Fidelity DNA Polymerase (NEB) with pETGFP 1-10 vector as a template (Cabantous et al. ...