Labshake search
Citations for New England Biolabs :
951 - 1000 of 5397 citations for 1 Piperidineacetamide 4 2 benzothiazolyl N 4 4 morpholinyl phenyl 9ci since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and both inserted between the XhoI and EcoRI sites of the parental pLVX N-term GFP vector using Gibson Assembly (New England Biolabs), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... was fused to an HA-tag at its N-terminus during PCR and cloned into the lentiviral vector pLJM1 linearized with AgeI (NEB) and EcoRI (NEB ...
-
bioRxiv - Genomics 2021Quote: The AID N-terminal AID-RPB1 vector was assembled by Gibson Assembly (NEBuilder HiFi DNA Assembly Master Mix, NEB, E2621L) in the pENTR221 kanamycin vector using the following templates ...
-
bioRxiv - Biochemistry 2021Quote: ... using a plasmid that codes for the desired protein sequence fused to an N-terminal intein and chitin binding domain (CBD) as part of the IMPACT purification system (NEB). 2 liters of cells were grown to an OD600 of 0.6 and induced with 1 mM IPTG for 3 hours at 25 °C ...
-
bioRxiv - Microbiology 2021Quote: ... The fragment of sNTurboID was PCR amplified from pLX304 CMV FKBP-V5-sTurboID (N) and cloned into the pcDNA5-VP35-HA using NEBuilder HiFi DNA Assembly Master Mix (NEB). The fragment of VP35-sNTurboID ...
-
bioRxiv - Cancer Biology 2020Quote: ... were added to each quadrant of the 96-well plate (n = 24 unique adapters) with a ligation mixture of 40 Weiss U T4 ligase (NEB), 1mM ATP (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... Point mutations were introduced in the P and N sequences by site-directed mutagenesis using the Q5 site-directed mutagenesis Kit (New England Biolabs). Sequence analysis was carried out to check the integrity of all constructs ...
-
bioRxiv - Genetics 2020Quote: ... An 18-mer poly-N barcode was created by annealing primers (Table S1) and extended to make fully double stranded with Klenow polymerase (NEB). The barcode was then PCR purified (Qiagen ...
-
bioRxiv - Synthetic Biology 2023Quote: ... was inserted into a gel-purified N-terminal sub-cloning vector digested with MluI and KpnI restriction enzymes (New England Biolabs). Cas13 C-terminal fragments were also PCR amplified out of the full Cas13 sequence templates mentioned above to contain a 5′ sequence to code for the KpnI restriction site a start codon ...
-
bioRxiv - Microbiology 2023Quote: ... Point mutations were introduced in the N sequence by site-directed mutagenesis using the Q5 site-directed mutagenesis Kit (New England Biolabs). Sequence analysis was carried out to check the integrity of all constructs ...
-
bioRxiv - Bioengineering 2023Quote: ... TADs were directly fused to the N-terminus to dCas9 by digesting the FLAG-NLS-MCS-linker-dCas9 plasmid with AgeI (NEB) and then cloning in PCR-amplified TADs using NEBuilder HiFi DNA Assembly ...
-
bioRxiv - Cell Biology 2023Quote: ... was fused in frame to the N-terminus of LRRK2 between the PreScission recognition sequence and NotI restriction site using HiFi assembly (NEB). A plasmid encoding Rab8 was previously generated in the De Camilli lab.
-
bioRxiv - Microbiology 2022Quote: ... and Atd1 and containing an N-terminal TEV cleavage site were cloned directly via Gibson assembly (NEBuilder HiFi, New England Biolabs) into BamHI/NotI-digested pGEX4-1 (GE Healthcare) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT) within loxP-N with the lox17:2272 site (ATAACTTCGTATAGGATACTTTATAGCAATTTAT) using a Q5 Site-Directed Mutagenesis kit (New England Biolabs) and PCR ...
-
bioRxiv - Immunology 2024Quote: N-linked glycans were enzymatically released from purified mouse THP using PNGase-F kit (catalog no P0709S, New England Biolabs). N-glycans were then purified from the reaction mixture containing denaturing buffer and de-N-glycosylated proteins by solid phase extraction method using Sep-Pak C18 (1 cc Vac-cartridges ...
-
bioRxiv - Cell Biology 2024Quote: ... Library preparation was slightly different and performed using the NEBNext® rRNA Depletion kit and protocol (NEB; P/N: E7850X) per manufacturer recommendations ...
-
bioRxiv - Biochemistry 2023Quote: ... The pCR8[mZC3H18] plasmid was used as a template to generate subsequent ZC3H18 cDNA constructs that were cloned into a piggyBAC (pB) vector containing an N-terminal MYC tag and BSD selection marker using NEBbuilder HiFI DNA assembly (NEB). OsTIR1-HA ...
-
bioRxiv - Plant Biology 2024Quote: ... in an N-terminal fusion (MIROs are tail anchored proteins) with mCherry that was generated by Gibson assembly (New England Biolabs, Ipswich ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing an N-terminal 6xHis tag and TEV site was produced in Escherichia coli NiCo21 (DE3) cells (New England Biolabs) as previously described in https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6069193/ ...
-
bioRxiv - Microbiology 2022Quote: ... Mutations to the specificity of guides in pTREX-n-Cas9 were performed using a Q5 mutagenesis kit (NEB, Ipswich, Massachusetts). Guides targeting the ELO genes were inserted using the primers described in Table 1 ...
-
bioRxiv - Cell Biology 2022Quote: ... All hybrid constructs were tested for expression and cloned into the pcDNA5/FRT/TO-N-FLAG-hBirA* using restriction enzymes: 5’ KpnI (NEB) and 3’ NotI (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... double and triple N>G mutations were introduced in the parental constructs by using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) according to the manufacturers protocols and using custom designed primer ...
-
bioRxiv - Cancer Biology 2024Quote: ... Shipston and was N-terminally attached to an RFP (BKCa-DECRFP) using KpnI and BamHI restriction sites after PCR amplification (NEB Q5 High-Fidelity DNA-Polymerase ...
-
bioRxiv - Plant Biology 2024Quote: ... where X is the relevant amino acid at the position of n has been substituted with the Cys) were generated by primer-based mutagenesis (New England Biolabs). The full-length precursor to cpTatC with the transit peptide from the precursor to the small subunit of RuBisCO in pGEM-4Z was used as the template (Aldridge et al. ...
-
bioRxiv - Neuroscience 2024Quote: Total RNA was isolated from frozen hDRG tissue and GBP- or vehicle-treated primary hDRG cultures (n = 3 per condition) using the Monarch Total RNA Miniprep Kit (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... crescentus NA1000 was PCR amplified from genomic DNA and cloned into pET28a with an N-terminal hexa-histidine tag using Gibson assembly (HiFi DNA Assembly Master Mix; New England Biolabs) to generate pET28a::cpaF ...
-
bioRxiv - Microbiology 2024Quote: ... Ligation with gentamycin cassette PCR amplified from the plasmid pACEBac1 (GenevaBiotech) was performed O/N at 16 °C using T4 DNA Ligase (NEB). Competent E ...
-
bioRxiv - Molecular Biology 2024Quote: ... These were then used as templates to introduce into a piggyBAC (pB) vector containing an N- terminal MYC and miniTurbo (MYC-mTurbo) tag using NEBbuilder HiFi DNA assembly (NEB). Wildtype mES cells were transfected with pB[MYC-] or pB[MYC-mTurbo-PHAX] vectors along with a piggyBAC transposase expressing vector (pBase ...
-
bioRxiv - Biophysics 2024Quote: ... Positively supercoiled DNA was prepared by incubating with 9°N Reverse Gyrase (5 units/μg DNA, M0200, provided by New England Biolabs) in 35 mM Tris-HCl (pH 7.5 at 25 °C) ...
-
bioRxiv - Genetics 2024Quote: ... Sequences encoding N-terminal Ana1 fragments were fused with C-terminal RFP using the Gibson Assembly system (New England Biolabs) before cloned into the modified vector.
-
bioRxiv - Cell Biology 2024Quote: ... It was amplified with myc tag at its N-terminal and cloned into a PUAST-attB vector using Not1 and Xba1 restriction enzymes (NEB). This was used as the parent vector for generation of all further domain deletion constructs ...
-
bioRxiv - Cell Biology 2024Quote: ... were cloned into the pGEX-6P1 vector using BamHI/XhoI restriction sites and expressed as a 3C protease-cleavable N-terminal GST-fusion protein in BL21 (DE3) cells (NEB). A 20mL LB overnight culture was inoculated into 1L of LB medium supplemented with 100μg/mL ampicillin to an OD600 of 0.05 and incubated at 37°C ...
-
bioRxiv - Plant Biology 2021Quote: ... #ltp1.4ltp1.8-1 and #ltp1.4ltp1.8-2) were chosen for constructing next generation sequencing libraries following the manufacture’s protocol (NEB Next Ultra II DNA kit). Sequencing was carried out using 2 × 150 paired-end NextSeq500 (1-2 Mio reads for all samples together ...
-
bioRxiv - Biochemistry 2021Quote: ... for 2 hr at 60 °C and relinearized at the basic dSpacer furan with Ape 1 (15 U; M0282S, NEB, Ipswich, MA) for 2 hr at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... Triplicate NEBuilder HiFi assembly reactions were prepared according to manufacturer’s protocols containing ∼2:1 insert to vector as follows: 10 µl of 2X NEBuilder HiFi master mix (New England Biolabs, cat#E2621S), 158.7 ng of DNA fragments ...
-
bioRxiv - Immunology 2021Quote: ... The linearized vector and the synthesized fragment in a 1:2 molar ratio were assembled with the NEBuilder HiFi DNA Assembly Kit (NEB, Ipswich, USA) at 50°C for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... TopBP1 full-length cDNA (a kind gift from Lee Zou) was amplified by PCR with primers 1 and 2 using Phusion® High-Fidelity DNA Polymerase (New England Biolabs, CM0530). The forward and reverse primers contain AscI and NotI sites ...
-
bioRxiv - Microbiology 2020Quote: ... and use of a specific barcode from the NEBNext® Multiplex Oligos for Illumina® Index Primers Set 1 or 2 (New England Biolabs). Quality and quantity of total RNA ...
-
bioRxiv - Immunology 2021Quote: ... Add 30 μl PCR master mix (2.5 μl Illumina dual indexes primer 1, 2.5 μl Illumina dual index primer 2, 25 μl NEB Q5 HotStart Master Mix) to the 20 μl beads bound with samples ...
-
bioRxiv - Plant Biology 2023Quote: ... The up- and downstream flanks were obtained by PCR on gDNA of IPO323 with primer pairs 1&2 and 5&6 (Table S7) respectively using Q5 Hot Start High fidelity DNA polymerase (NEB, Evry, France). The hph was amplified from pCAMBIA0380 with the primers 3 and 4 (Table S7) ...
-
bioRxiv - Biochemistry 2024Quote: ... coli (Suppl. Table 1) were cloned into a pBAD24 with ampicillin resistance using the USER cloning method (New England Biolabs, Table 2). All sequences were cloned including a 10x histidine tag located in the N-terminus for BtuG1-3 and the C-terminus for BtuG2 and all its mutants ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 37° C for 2 hrs from 1 µg purified dsDNAs using a T7 high yield RNA synthesis kit (NEB, Cat # E2040S) in a total volume of 20 µL ...
-
bioRxiv - Immunology 2021Quote: ... the samples were added to 2 μL of second-strand synthesis mix containing 2.25× NEB buffer 2 (NEB), 0.625mM each dNTP Mixture (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... The purified products were subjected to dA tailing with 2 μL of 10X NEBuffer 2 (New England BioLabs), 0.1 μL of 100 mM dATP ...
-
bioRxiv - Genomics 2024Quote: ... 2 μL of 10% Tween-20 and 5 μL NEBNext High-fidelity 2× PCR Master Mix (NEB, M0541) was added to each well sequentially ...
-
bioRxiv - Biochemistry 2024Quote: ... the reaction described above included another 2 µL of mRNA cap 2′-O-methyltransferase (50 U/µL, NEB). The capping reaction was incubated at 37°C for 4 h ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein Phosphatase Inhibitor 2 (New England Biolabs) and Trichostatin A HDAC inhibitor (TSA ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 µl 10 mM ATP (NEB, 0756), 1 µl 100 mM DTT (Cell Signaling Technology Europe ...
-
bioRxiv - Cell Biology 2020Quote: ... in 1x glycobuffer 2 (New England Biolabs), and 10% NP-40 (New England Biolabs ...
-
bioRxiv - Genomics 2020Quote: ... and 2 μL T4 PNK (NEB, M0201L) were added to the sample in respective order ...