Labshake search
Citations for New England Biolabs :
51 - 100 of 1209 citations for Rabbit Anti West Nile Virus Envelope Protein Antibody 9E2 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and Moloney murine leukemia virus reverse transcriptase (New England Biolabs). Using a QuantStudio 3 real-time quantitative PCR machine (Life Technologies) ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit anti-SNAP-tag (P9310, New England BioLabs), rabbit anti-beta-tubulin (NB600-936 ...
-
bioRxiv - Cell Biology 2020Quote: ... Pan anti-trimethyllysine (rabbit, PTM Biolabs, PTM-601), SETD2 (rabbit ...
-
bioRxiv - Cell Biology 2019Quote: ... or rabbit anti-GAPDH (2118S NEB, 1:5000) primary antibody with horseradish peroxidase-conjugated anti-mouse or anti-rabbit (Dianova 1:10,000 ...
-
bioRxiv - Cell Biology 2022Quote: ... rabbit anti-Gaussia luciferase (E8023, New England Biolabs) at a 1:2,000 dilution ...
-
bioRxiv - Biochemistry 2019Quote: ... Immunoblotting was performed using HRP-conjugated anti-maltose binding protein (MBP) monoclonal antibody at 1:10000 dilution (New England Biolabs, #E8038) to verify equal expression levels of each construct.
-
bioRxiv - Cancer Biology 2022Quote: ... antibody and anti-Gluc antibody (New England Biolabs, ref. E8023).
-
bioRxiv - Developmental Biology 2023Quote: ... a MBP antibody (Anti-MBP Monoclonal Antibody, HRP conjugated, NEB), a GST antibody (GST Tag Monoclonal Antibody ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein blots were incubated with primary antibodies overnight at 4°C using the above-mentioned antibodies and the Gaussia Rabbit Polyclonal Antibody (E8023S, New England BioLabs), the Influenza A NS1 Mouse Monoclonal Antibody (sc-130568 ...
-
bioRxiv - Cell Biology 2022Quote: ... only centriolar pairs that could be tracked from the beginning of nuclear cycle 12 until nuclear envelope breakdown (NEB) (for Sas-6)/beginning of nuclear cycle 13 (for Ana2)/throughout the entire detection window of the oscillation (for Plk4 ...
-
bioRxiv - Cell Biology 2023Quote: ... Envelope gene mutations were introduced into WT cDNA sequence using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). All cloned were sequenced (Eurofins).
-
bioRxiv - Cell Biology 2022Quote: ... SNAP-GLP-1R and SNAP-GIPR were detected with an anti-SNAP-tag rabbit polyclonal antibody (P9310S, New England Biolabs, 1/1,000) followed by goat anti-rabbit HRP secondary (ab6271 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Membranes were incubated overnight at 4 °C with the appropriate antibody: rabbit monoclonal anti-GSK3β (1:1,000; product # 9315, Cell Signalling Technology, New England BioLabs, Whitby, Ontario, Canada), rabbit polyclonal anti-p[Ser9]GSK3β (1:500 ...
-
bioRxiv - Zoology 2020Quote: ... Moloney murine leukemia virus reverse transcriptase (New England Biolabs, Evry, France) and random hexamer primers were used to transcribe 1 μg RNA in a 20 μl reaction into cDNA.
-
bioRxiv - Developmental Biology 2021Quote: ... All oligos were radioactively capped using Vaccinia virus capping system (NEB) and [α-32P]-GTP (Perkin-Elmer) ...
-
bioRxiv - Plant Biology 2021Quote: ... Anti-MBP murin monoclonal antibody (Biolabs) was immobilized (around 11000 responsive units (RU) ...
-
bioRxiv - Biochemistry 2023Quote: ... anti-Kcr antibody (PTM Biolabs, PTM502), anti-Ub antibody (Santa Cruz Biotechnology ...
-
bioRxiv - Microbiology 2021Quote: ... Nitrocellulose membrane-transferred proteins were incubated with anti-PfGet3 or anti-MBP (NEB), probed with corresponding HRP-conjugated secondary antibodies and developed by chemiluminescence.
-
bioRxiv - Cell Biology 2023Quote: ... incubations were performed with primary rabbit antibody against N6-methyladenosine (NEB) or PAB2 (courtesy of Cecile Bousquet-Antonelli and Rémy Merret ...
-
bioRxiv - Immunology 2021Quote: ... Antibodies were then coupled to protein G beads (New England Biolabs). After beads were washed ...
-
bioRxiv - Cell Biology 2022Quote: ... rabbit polyclonal anti-SNAP-tag (New England BioLabs, P9310S), mouse monoclonal anti-HSP90 (BD Transduction Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... anti-maltose binding protein (MPB) (New England BioLabs #E8032L) and anti-outer membrane protein (OmpA ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The cDNA was then used as template to amplify the envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). Nested PCRs were performed ...
-
bioRxiv - Immunology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). The envelope amplicons were purified ...
-
bioRxiv - Immunology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). First round primers consisted of forward primer VIF2 (5’ – GGGTTTATTACAGAGACAGCAGAG – 3’ ...
-
bioRxiv - Microbiology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). The envelope amplicons were purified ...
-
bioRxiv - Cell Biology 2022Quote: Cytokinetic furrowing rate measurements for both the P0 cell and the AB cell were taken relative to nuclear envelope breakdown (NEB). For all analyses ...
-
bioRxiv - Molecular Biology 2021Quote: All eight gene segments of the isolated H6N1 virus were amplified (NEB), purified (Omega ...
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibody (1:10.000, used with 1:10.000 secondary horseradish peroxidase-conjugated anti-mouse antibody; NEB).
-
bioRxiv - Plant Biology 2023Quote: ... a CP29A specific rabbit antisera (Kupsch et al., 2012) or anti-SNAP rabbit antisear (NEB, Frankfurt, Germany) in 1:2000 dilution overnight at 4°C and subsequently washed with TBST buffer four times at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... Primary antibodies (Anti-3-hydroxybutyryllysine [PTM Biolabs 1201] ...
-
bioRxiv - Biochemistry 2020Quote: ... Anti-butyryllysine antibody (PTM BioLabs, PTM#301) at 1:2000 dilution was incubated with the membrane overnight at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... rabbit anti-GFP (1:1000; TP401, Torrey Pine Biolabs, RRID:AB_10013661), mouse anti-GFP (1:1000 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and anti-MBP antibody (NEB E8032L; 1:10,000) in 1x TBST supplemented with 5% low-fat milk were incubated either at 4 °C overnight or 1 hr at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... Virus stocks were recovered following linearization of infectious clone plasmids using NotI-HF (NEB), in vitro transcription ...
-
bioRxiv - Microbiology 2022Quote: ... The virus lysate was then denatured by boiling in denaturing buffer (New England BioLabs) for 10 min and treated with PNGase F or Endo Hf enzymes (New England BioLabs ...
-
bioRxiv - Biophysics 2023Quote: ... The mRNAs were capped using the vaccinia virus capping enzyme kit (New England Biolabs) following the manufacturer’s protocols ...
-
bioRxiv - Immunology 2022Quote: ... As an isotype control an unspecific polyclonal rabbit antibody was used (NEB, Frankfurt, Germany). To block ORF8 during differentiation it was preincubated with the polyclonal rabbit anti-ORF8 antibody or isotype over night and added to the monocytes (t=0 ...
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit anti-SNAP (1:1000, polyclonal, New England Biolabs, Ipswich, MA, P9310S), or mouse anti-tubulin (1:40,000 ...
-
bioRxiv - Microbiology 2020Quote: ... Anti-rabbit IgG (H+L) (DyLight™ 800 4X PEG Conjugate, NEB) or anti-mouse IgG (H+L ...
-
bioRxiv - Microbiology 2019Quote: ... and detected using anti-MBP antibodies (New England Biolabs).
-
bioRxiv - Developmental Biology 2019Quote: ... incubated overnight with anti-SNAP antibody (NEB, Ipswich, MA), washed and probed with goat-anti-rabbit horseradish peroxidase secondary antibody (Invitrogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... and detected using the anti-MBP-HRP antibody (NEB). The bound protein (~42kDa ...
-
bioRxiv - Molecular Biology 2022Quote: Anti-M13-pIII monoclonal antibody (E8033S, New England Biolabs), sheep anti-mouse IgG (H/L):HRP (AAC10P ...
-
bioRxiv - Plant Biology 2023Quote: ... after which an anti-p42/p44-erk antibody (NEB) was employed to detect the activated MAPKs on western blots.
-
bioRxiv - Cell Biology 2023Quote: ... anti-SNAP-tag antibody (New England Biolabs, Ref. P9310S), anti-clathrin heavy chain antibody (BD Bioscience ...
-
bioRxiv - Microbiology 2024Quote: ... and detected using anti-MBP antibodies (New England Biolabs). As a negative control ...
-
bioRxiv - Microbiology 2020Quote: Virus-encoding plasmids were generated using Gibson Assembly (NEB Gibson Assembly kit, NEB, Ipswich, MA). Insert amplicons containing 25 bp overlaps to target regions were generated using Kapa HiFi Hotstart™ high-fidelity polymerase (Kapa Biosystems/Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: Virus-encoding plasmids were generated using Gibson Assembly (NEB Gibson Assembly kit, NEB, Ipswich, MA). Insert amplicons containing 25 bp overlaps to target regions were generated using Kapa HiFi Hotstart™ high-fidelity polymerase (Kapa Biosystems/Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: Virus stocks were generated by either transfecting purified in vitro transcribed viral RNA (HiScribe, NEB) or transfecting the infectious cDNA clone containing plasmid in BHK-T7 cells ...