Labshake search
Citations for New England Biolabs :
51 - 100 of 1169 citations for Rabbit Anti Flavivirus Envelope Protein Antibody 4G2 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... or rabbit anti-GAPDH (2118S NEB, 1:5000) primary antibody with horseradish peroxidase-conjugated anti-mouse or anti-rabbit (Dianova 1:10,000 ...
-
bioRxiv - Cell Biology 2022Quote: ... rabbit anti-Gaussia luciferase (E8023, New England Biolabs) at a 1:2,000 dilution ...
-
bioRxiv - Biochemistry 2019Quote: ... Immunoblotting was performed using HRP-conjugated anti-maltose binding protein (MBP) monoclonal antibody at 1:10000 dilution (New England Biolabs, #E8038) to verify equal expression levels of each construct.
-
bioRxiv - Cancer Biology 2022Quote: ... antibody and anti-Gluc antibody (New England Biolabs, ref. E8023).
-
bioRxiv - Developmental Biology 2023Quote: ... a MBP antibody (Anti-MBP Monoclonal Antibody, HRP conjugated, NEB), a GST antibody (GST Tag Monoclonal Antibody ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein blots were incubated with primary antibodies overnight at 4°C using the above-mentioned antibodies and the Gaussia Rabbit Polyclonal Antibody (E8023S, New England BioLabs), the Influenza A NS1 Mouse Monoclonal Antibody (sc-130568 ...
-
bioRxiv - Cell Biology 2022Quote: ... only centriolar pairs that could be tracked from the beginning of nuclear cycle 12 until nuclear envelope breakdown (NEB) (for Sas-6)/beginning of nuclear cycle 13 (for Ana2)/throughout the entire detection window of the oscillation (for Plk4 ...
-
bioRxiv - Cell Biology 2023Quote: ... Envelope gene mutations were introduced into WT cDNA sequence using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). All cloned were sequenced (Eurofins).
-
bioRxiv - Cell Biology 2022Quote: ... SNAP-GLP-1R and SNAP-GIPR were detected with an anti-SNAP-tag rabbit polyclonal antibody (P9310S, New England Biolabs, 1/1,000) followed by goat anti-rabbit HRP secondary (ab6271 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Membranes were incubated overnight at 4 °C with the appropriate antibody: rabbit monoclonal anti-GSK3β (1:1,000; product # 9315, Cell Signalling Technology, New England BioLabs, Whitby, Ontario, Canada), rabbit polyclonal anti-p[Ser9]GSK3β (1:500 ...
-
bioRxiv - Plant Biology 2021Quote: ... Anti-MBP murin monoclonal antibody (Biolabs) was immobilized (around 11000 responsive units (RU) ...
-
bioRxiv - Biochemistry 2023Quote: ... anti-Kcr antibody (PTM Biolabs, PTM502), anti-Ub antibody (Santa Cruz Biotechnology ...
-
bioRxiv - Microbiology 2021Quote: ... Nitrocellulose membrane-transferred proteins were incubated with anti-PfGet3 or anti-MBP (NEB), probed with corresponding HRP-conjugated secondary antibodies and developed by chemiluminescence.
-
bioRxiv - Cell Biology 2023Quote: ... incubations were performed with primary rabbit antibody against N6-methyladenosine (NEB) or PAB2 (courtesy of Cecile Bousquet-Antonelli and Rémy Merret ...
-
bioRxiv - Immunology 2021Quote: ... Antibodies were then coupled to protein G beads (New England Biolabs). After beads were washed ...
-
bioRxiv - Cell Biology 2022Quote: ... rabbit polyclonal anti-SNAP-tag (New England BioLabs, P9310S), mouse monoclonal anti-HSP90 (BD Transduction Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... anti-maltose binding protein (MPB) (New England BioLabs #E8032L) and anti-outer membrane protein (OmpA ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The cDNA was then used as template to amplify the envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). Nested PCRs were performed ...
-
bioRxiv - Immunology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). The envelope amplicons were purified ...
-
bioRxiv - Immunology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). First round primers consisted of forward primer VIF2 (5’ – GGGTTTATTACAGAGACAGCAGAG – 3’ ...
-
bioRxiv - Microbiology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). The envelope amplicons were purified ...
-
bioRxiv - Cell Biology 2022Quote: Cytokinetic furrowing rate measurements for both the P0 cell and the AB cell were taken relative to nuclear envelope breakdown (NEB). For all analyses ...
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibody (1:10.000, used with 1:10.000 secondary horseradish peroxidase-conjugated anti-mouse antibody; NEB).
-
bioRxiv - Plant Biology 2023Quote: ... a CP29A specific rabbit antisera (Kupsch et al., 2012) or anti-SNAP rabbit antisear (NEB, Frankfurt, Germany) in 1:2000 dilution overnight at 4°C and subsequently washed with TBST buffer four times at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... Primary antibodies (Anti-3-hydroxybutyryllysine [PTM Biolabs 1201] ...
-
bioRxiv - Biochemistry 2020Quote: ... Anti-butyryllysine antibody (PTM BioLabs, PTM#301) at 1:2000 dilution was incubated with the membrane overnight at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... rabbit anti-GFP (1:1000; TP401, Torrey Pine Biolabs, RRID:AB_10013661), mouse anti-GFP (1:1000 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and anti-MBP antibody (NEB E8032L; 1:10,000) in 1x TBST supplemented with 5% low-fat milk were incubated either at 4 °C overnight or 1 hr at room temperature ...
-
bioRxiv - Immunology 2022Quote: ... As an isotype control an unspecific polyclonal rabbit antibody was used (NEB, Frankfurt, Germany). To block ORF8 during differentiation it was preincubated with the polyclonal rabbit anti-ORF8 antibody or isotype over night and added to the monocytes (t=0 ...
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit anti-SNAP (1:1000, polyclonal, New England Biolabs, Ipswich, MA, P9310S), or mouse anti-tubulin (1:40,000 ...
-
bioRxiv - Microbiology 2020Quote: ... Anti-rabbit IgG (H+L) (DyLight™ 800 4X PEG Conjugate, NEB) or anti-mouse IgG (H+L ...
-
bioRxiv - Microbiology 2019Quote: ... and detected using anti-MBP antibodies (New England Biolabs).
-
bioRxiv - Developmental Biology 2019Quote: ... incubated overnight with anti-SNAP antibody (NEB, Ipswich, MA), washed and probed with goat-anti-rabbit horseradish peroxidase secondary antibody (Invitrogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... and detected using the anti-MBP-HRP antibody (NEB). The bound protein (~42kDa ...
-
bioRxiv - Molecular Biology 2022Quote: Anti-M13-pIII monoclonal antibody (E8033S, New England Biolabs), sheep anti-mouse IgG (H/L):HRP (AAC10P ...
-
bioRxiv - Plant Biology 2023Quote: ... after which an anti-p42/p44-erk antibody (NEB) was employed to detect the activated MAPKs on western blots.
-
bioRxiv - Cell Biology 2023Quote: ... anti-SNAP-tag antibody (New England Biolabs, Ref. P9310S), anti-clathrin heavy chain antibody (BD Bioscience ...
-
bioRxiv - Microbiology 2024Quote: ... and detected using anti-MBP antibodies (New England Biolabs). As a negative control ...
-
bioRxiv - Biochemistry 2021Quote: ... 1μL m6A antibody per sample was coupled to pre-washed Protein G Magnetic Beads (NEB) in 1x reaction buffer (150mM NaCl ...
-
bioRxiv - Biochemistry 2023Quote: ... Using 10 μg of custom-made rabbit polyclonal anti-AcK142 Ab (Ez Biolabs), AcK142 PNKP was IP’d from 1 mg of GO-treated chromatin fraction from WT-PNKP-FLAG and K142R-PNKP-FLAG expressing cells ...
-
bioRxiv - Plant Biology 2023Quote: ... MBP-tagged and GST-tagged proteins were detected using anti-MBP (E8032S, NEB) and anti-GST antibody (60-021 ...
-
bioRxiv - Microbiology 2021Quote: ... or 5 µl anti-H3K18cr antibody (PTM-517, PTM Biolabs) together with protein A agarose (Roche ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 μl anti-MBP Monoclonal Antibody (New England Biolabs, #E8032L) and 6 μl anti-E ...
-
bioRxiv - Physiology 2020Quote: ... Membranes were washed with TBS-T and then incubated with an anti-rabbit horseradish peroxidase conjugated secondary antibody (New England Biolabs, 1:10,000 in 5% skim milk in TBS-T) for 2h ...
-
bioRxiv - Cancer Biology 2021Quote: ... or a polyclonal rabbit antibody against cleaved casp-3 (1:100; New England Biolabs, Frankfurt, Germany), followed by a biotinylated goat anti-rabbit secondary antibody (Abcam ...
-
bioRxiv - Molecular Biology 2021Quote: ... The antibodies were captured using 50 µl of protein G magnetic beads (S1430, New England Biolabs) incubated for 60 min with end over end mixing at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... The lysate-antibody mix was then incubated with Magnetic Protein A beads (New England Biolabs, S1425S) overnight at 4 °C with end over rotation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatants were immunoprecipitated overnight with 40 µL of precoated anti-IgG magnetic beads (goat anti-rabbit IgG magnetic beads, NEB) previously incubated with the antibody of interest for 4 h at 4°C ...
-
bioRxiv - Plant Biology 2019Quote: ... Lysates pre-cleared for 15 minutes with 50µl goat anti-rabbit magnetic beads (NEB). Pre-cleared lysates were then incubated with either goat anti-rabbit magnetic beads only (mock IP ...
-
bioRxiv - Molecular Biology 2023Quote: ... Rabbit polyclonal anti-SNAP-tag (Cat no. P9310S, New England Biolabs, 1:1000 dilution). Secondary antibodies used were ...