Labshake search
Citations for New England Biolabs :
51 - 100 of 1320 citations for Mouse Anti Dengue Pan Envelope Protein Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... Immunoblotting was performed using HRP-conjugated anti-maltose binding protein (MBP) monoclonal antibody at 1:10000 dilution (New England Biolabs, #E8038) to verify equal expression levels of each construct.
-
bioRxiv - Biochemistry 2023Quote: ... mouse monoclonal antibodies against PAR (clone 10H, Tulip BioLabs, USA), anti-mouse antibodies conjugated with horseradish peroxidase (Bio-Rad ...
-
bioRxiv - Cancer Biology 2022Quote: ... antibody and anti-Gluc antibody (New England Biolabs, ref. E8023).
-
bioRxiv - Developmental Biology 2023Quote: ... a MBP antibody (Anti-MBP Monoclonal Antibody, HRP conjugated, NEB), a GST antibody (GST Tag Monoclonal Antibody ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-MBP (New England Biolabs, RRID:AB_ 1559738), used at 1:5000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... mouse anti-PPARα (1:25, Arigo Biolabs ARG55240). Alexa Fluor conjugated secondary antibodies (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... only centriolar pairs that could be tracked from the beginning of nuclear cycle 12 until nuclear envelope breakdown (NEB) (for Sas-6)/beginning of nuclear cycle 13 (for Ana2)/throughout the entire detection window of the oscillation (for Plk4 ...
-
bioRxiv - Cell Biology 2023Quote: ... Envelope gene mutations were introduced into WT cDNA sequence using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). All cloned were sequenced (Eurofins).
-
bioRxiv - Plant Biology 2021Quote: ... Anti-MBP murin monoclonal antibody (Biolabs) was immobilized (around 11000 responsive units (RU) ...
-
bioRxiv - Biochemistry 2023Quote: ... anti-Kcr antibody (PTM Biolabs, PTM502), anti-Ub antibody (Santa Cruz Biotechnology ...
-
bioRxiv - Microbiology 2021Quote: ... Nitrocellulose membrane-transferred proteins were incubated with anti-PfGet3 or anti-MBP (NEB), probed with corresponding HRP-conjugated secondary antibodies and developed by chemiluminescence.
-
bioRxiv - Immunology 2021Quote: ... Antibodies were then coupled to protein G beads (New England Biolabs). After beads were washed ...
-
bioRxiv - Microbiology 2020Quote: ... anti-maltose binding protein (MPB) (New England BioLabs #E8032L) and anti-outer membrane protein (OmpA ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The cDNA was then used as template to amplify the envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). Nested PCRs were performed ...
-
bioRxiv - Immunology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). The envelope amplicons were purified ...
-
bioRxiv - Immunology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). First round primers consisted of forward primer VIF2 (5’ – GGGTTTATTACAGAGACAGCAGAG – 3’ ...
-
bioRxiv - Microbiology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). The envelope amplicons were purified ...
-
bioRxiv - Cell Biology 2022Quote: Cytokinetic furrowing rate measurements for both the P0 cell and the AB cell were taken relative to nuclear envelope breakdown (NEB). For all analyses ...
-
Cdc42 promotes epithelial morphogenesis by coupling Par-complex and Crumbs recruitment via Par6-aPKCbioRxiv - Cell Biology 2019Quote: ... anti-MBP mouse 1/80,000 (E8032S, New England Biolabs). Western Blots were quantified using Fiji ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-myc (NEB/Cell Signaling, 2276; 1:1500) o/n at 4 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Primary antibodies (Anti-3-hydroxybutyryllysine [PTM Biolabs 1201] ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit polyclonal anti-lactyllysine antibody (PTM Biolabs), or mouse monoclonal anti-β-actin antibody (A5316 ...
-
bioRxiv - Biochemistry 2020Quote: ... Anti-butyryllysine antibody (PTM BioLabs, PTM#301) at 1:2000 dilution was incubated with the membrane overnight at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were stained with mouse anti-MBP (NEB, 1:500), followed by washing and subsequent incubation with goat anti-mouse IgG ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were stained with mouse anti-MBP (NEB, 1:500), followed by washing and subsequent incubation with goat anti-mouse IgG ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse monoclonal anti-MBP (New England Biolabs, E8032; 1:10,000), rabbit polyclonal anti-GAPDH (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2022Quote: ... and anti-MBP antibody (NEB E8032L; 1:10,000) in 1x TBST supplemented with 5% low-fat milk were incubated either at 4 °C overnight or 1 hr at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... MBP fusion proteins were detected with a rabbit anti-MBP from NEB company 1:1000 followed by an incubation with a goat anti-rabbit HRP-conjugated (1:3000) ...
-
bioRxiv - Microbiology 2019Quote: ... and detected using anti-MBP antibodies (New England Biolabs).
-
bioRxiv - Developmental Biology 2019Quote: ... incubated overnight with anti-SNAP antibody (NEB, Ipswich, MA), washed and probed with goat-anti-rabbit horseradish peroxidase secondary antibody (Invitrogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... and detected using the anti-MBP-HRP antibody (NEB). The bound protein (~42kDa ...
-
bioRxiv - Microbiology 2024Quote: ... and detected using anti-MBP antibodies (New England Biolabs). As a negative control ...
-
bioRxiv - Molecular Biology 2022Quote: Anti-M13-pIII monoclonal antibody (E8033S, New England Biolabs), sheep anti-mouse IgG (H/L):HRP (AAC10P ...
-
bioRxiv - Plant Biology 2023Quote: ... after which an anti-p42/p44-erk antibody (NEB) was employed to detect the activated MAPKs on western blots.
-
bioRxiv - Cell Biology 2023Quote: ... anti-SNAP-tag antibody (New England Biolabs, Ref. P9310S), anti-clathrin heavy chain antibody (BD Bioscience ...
-
bioRxiv - Biochemistry 2021Quote: ... 1μL m6A antibody per sample was coupled to pre-washed Protein G Magnetic Beads (NEB) in 1x reaction buffer (150mM NaCl ...
-
bioRxiv - Plant Biology 2023Quote: ... MBP-tagged and GST-tagged proteins were detected using anti-MBP (E8032S, NEB) and anti-GST antibody (60-021 ...
-
bioRxiv - Microbiology 2021Quote: ... or 5 µl anti-H3K18cr antibody (PTM-517, PTM Biolabs) together with protein A agarose (Roche ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 μl anti-MBP Monoclonal Antibody (New England Biolabs, #E8032L) and 6 μl anti-E ...
-
bioRxiv - Microbiology 2020Quote: ... or anti-mouse IgG (H+L) (DyLight™ 800 4X PEG Conjugate, NEB) were used as the secondary antibodies.
-
bioRxiv - Molecular Biology 2021Quote: ... The antibodies were captured using 50 µl of protein G magnetic beads (S1430, New England Biolabs) incubated for 60 min with end over end mixing at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... The lysate-antibody mix was then incubated with Magnetic Protein A beads (New England Biolabs, S1425S) overnight at 4 °C with end over rotation ...
-
bioRxiv - Developmental Biology 2019Quote: ... Bound antibodies were detected by incubation with anti-rabbit DyLight 800-conjugated secondary antibody (New England BioLabs). Slides were analysed using an InnoScan 710-IR scanner (Innopsys) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Bound antibodies were detected by incubation with anti-rabbit DyLight 800-conjugated secondary antibody (New England BioLabs). Slides were analysed using an InnoScan 710-IR scanner (Innopsys) ...
-
bioRxiv - Microbiology 2024Quote: ... The amplification product of pan-CoV semi-nested PCR was purified and concentrated by the Monarch PCR & DNA Cleanup Kit (NEB), according to the protocol supplied ...
-
bioRxiv - Microbiology 2021Quote: ... or murine anti-MBP monoclonal antibody (1:10,000; NEB; catalog# E8032S) in the above LI-COR blocking buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... We used rabbit polyclonal anti-lactyllysine antibody (PTM-1401, PTM Biolabs), mouse monoclonal anti-CaM Kinase II α subunit antibody (05-532 ...
-
bioRxiv - Immunology 2020Quote: ... RNA was then immunoprecipitated with anti-m6A antibody (New England Biolabs) overnight at 4°C with head-over-tail rotation ...
-
bioRxiv - Biochemistry 2020Quote: ... with anti-Knbu/Kibu as the positive control using anti-butyryllysine antibody (PTM Biolabs, Cat# PTM-301) and histone H3 as the loading control using histone H3 antibody (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 µg antibody (Table. S3) and 50 µl protein A magnetic beads (New England Biolabs, Cat. No. S1425S) were added to the supernatant and incubate overnight at 4 degree Celsius ...