Labshake search
Citations for New England Biolabs :
51 - 100 of 1720 citations for Dnase Free and Rnase Free Distilled Water since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... The RNA samples were treated with DNase I (NEB, RNase-free, Ipswich, MA, USA) and approximately 1 μg of RNA was reverse transcribed using SuperScriptTM II RT (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Isolated DNA was treated with DNase-free Monarch® RNase A (New England Biolabs) to get rid of any RNA contamination ...
-
bioRxiv - Immunology 2024Quote: ... washed in 10 mL RPMI+10% FBS + 2 µl RNase-free DNase I (NEB), and stained with LIVE/DEAD Aqua for 15 minutes at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... washed in 10 mL RPMI+10% FBS + 2 µl RNase-free DNase I (NEB), and placed in single-cell suspension in 1 mL RPMI+10% FBS ...
-
bioRxiv - Genomics 2024Quote: ... DNase I (2 µL, 2,000 U/ml, RNase-free, New England Biolabs, Ipswich, MA), 10× DNase buffer ...
-
bioRxiv - Bioengineering 2024Quote: ... RNase-free (New England Biolabs, #M0303S). Following quality control assessment ...
-
bioRxiv - Microbiology 2024Quote: ... pellets dried and resuspended in 100 µl RNase-free water containing 40 U murine RNase inhibitor (New England Biolabs). Following quantification by Nanodrop ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... treated ~2 μg RNA with RNase-free DNase I (Catalog# M0303S NEW ENGLAND Biolabs, USA), then used 1 μL treated RNA in cDNA synthesis with SuperScript III Reverse Transciptase (Invitrogen ...
-
bioRxiv - Genomics 2020Quote: ... The total RNA was then treated with RNase-free DNase I (New England BioLabs Inc.), and column purified using ISOLATE II RNA Mini Kit (Bioline ...
-
bioRxiv - Plant Biology 2021Quote: The extracted RNA was treated with RNase-free DNase (New England Biolabs, Ipswich, MA, USA). Quality control measurements were performed on a 2100 Bioanalyzer (Agilent ...
-
bioRxiv - Plant Biology 2021Quote: ... the extracted RNA was treated with RNase-free DNase I (New England Biolabs, https://www.neb.com) for 30 min at 37°C ...
-
bioRxiv - Plant Biology 2021Quote: ... the extracted RNA was treated with RNase-free DNase I (New England Biolabs, https://www.neb.com) for 30 min at 37°C ...
-
bioRxiv - Genetics 2022Quote: ... Then the reaction was diluted to 50µL and 2µL RNase-free DNase I (NEB, M0303S) were added ...
-
bioRxiv - Cell Biology 2024Quote: ... polymerase along with template was used for riboprobe synthesis and RNase free DNase (NEB M0303S) was used for template digestion ...
-
bioRxiv - Plant Biology 2024Quote: ... total RNA was treated with RNase-free DNase I (New England Biolabs, Ipswich, MA, USA) to remove any genomic DNA contamination ...
-
bioRxiv - Genetics 2024Quote: ... Contaminating genomic DNA was removed using an RNase-free DNase I (NEB, Ipswich, MA, USA) treatment and further controlled by RT-PCR using an intron-containing CcSOD gene.
-
bioRxiv - Microbiology 2022Quote: ... 2 units RNA-free DNAse (NEB) was added and reactions left at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2024Quote: ... including DNAseI (RNase free, New England Biolabs) digestion to remove genomic DNA ...
-
bioRxiv - Plant Biology 2024Quote: ... RNase-free (NEB®, catalog number M0303S). To 20 µL of RNA ...
-
bioRxiv - Plant Biology 2021Quote: ... total RNA samples were first treated with DNase I (RNase-free New England Biolabs® Inc.), per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... 5 units (2.5 μL) of RNase free DNAse I (NEW ENGLAND BioLabs, 2000 u. mL-1) and 100 μL of nuclease free water was added for every 10 μg of RNA ...
-
bioRxiv - Microbiology 2024Quote: ... Extracted RNA was treated with RNase-free DNase I (New England Biolabs [NEB], Ipswich, MA, USA) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Extracted RNA was treated with RNase-free DNase I (New England Biolabs [NEB], Ipswich, MA, USA) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNase-free DNase Buffer was added to samples until 1× final concentration together with 20 units of DNase I (NEB, M0303L) and incubated at 37°C for 20 minutes ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The total RNAs were treated with RNase-Free DNase I (New England BioLabs Japan Inc., Tokyo, Japan) to exclude remaining genomic DNA and purified by phenol/chloroform extraction and ethanol precipitation ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Extracted RNA was treated with 2% RNase-free DNase I (New England BioLabs Japan Inc., Tokyo, Japan) at 37°C for 40 minutes and purified by phenol/chloroform extraction and ethanol precipitation.
-
bioRxiv - Genetics 2020Quote: ... and the residual DNA was removed with RNase-free DNase I (New England BioLabs, Ipswich, MA, USA) for 30 min at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... was used to purify synthesized gRNA after DNase I (RNase-free) treatment (New England BioLabs, catalog# M0303S). 5 μg purified LbCas12a (New England BioLabs ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Extracted RNA was treated with 2% RNase-free DNase I (New England BioLabs Japan Inc., Tokyo, Japan) at 37°C for 40 minutes and purified by phenol/chloroform extraction and ethanol precipitation ...
-
bioRxiv - Molecular Biology 2021Quote: ... A fraction of total RNA (~20 μg) was treated with DNase I (RNase-free; New England Biolabs) at 37°C for 15 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The total RNAs were treated with RNase-Free DNase I (New England BioLabs Japan Inc., Tokyo, Japan) to exclude remaining genomic DNA and purified by phenol/chloroform extraction and ethanol precipitation ...
-
bioRxiv - Molecular Biology 2021Quote: RNA used for RT-PCR was treated with 8 U of DNase I (RNase-free, NEB, M0303) for 15 min at 37 °C in a 50 μl reaction ...
-
bioRxiv - Microbiology 2023Quote: ... in vitro-transcribed Tat/Rev RNA samples were treated with RNase-free DNase I (New England Biolabs) and purified using the Monarch® RNA Cleanup Kit (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 8 U/ml DNaseI (RNase-free, NEB, M0303L) were added to each sample ...
-
bioRxiv - Genomics 2024Quote: ... after which 68 µL RNase-free H2O was added with 10 µL DNase I Buffer and 2 µL DNase I (New England Biolabs, Ipswitch, MA). The resulting mix was incubated for 15m at 37°C ...
-
bioRxiv - Systems Biology 2020Quote: Single hematopoietic stem and progenitor cells were index-sorted into 384 well plates containing 0.5 µl of nuclease free water with 0.2% Triton-X 100 and 4 U murine RNase Inhibitor (NEB), spun down and frozen at −80°C ...
-
bioRxiv - Immunology 2021Quote: ... into 384 well plates containing 0.5 µl of nuclease free water with 0.2% Triton-X 100 and 4 U murine RNase Inhibitor (NEB), spun down and frozen at −80°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... the total RNA samples were treated with RNase-free deoxyribonuclease I (DNase I) (New England BioLabs, Beverly, MA) to remove residual DNA ...
-
bioRxiv - Biophysics 2020Quote: ... followed by treatment for 1 h at 37 °C with 2.5 units of RNase-free DNase I (NEB). The sample was once again cleaned with RNeasy MinElute Cleanup Kit before applying on a 1% agarose gel for gel extraction and purification with QIAGEN gel extraction kit and elution with RNase free H2O ...
-
bioRxiv - Cancer Biology 2024Quote: ... Pelleted RNA was resuspended in 20 µL nuclease-free water and treated with DNase I (New England BioLabs) for 10 minutes at 37°C in the presence of RNasin Ribonuclease Inhibitor (Promega) ...
-
bioRxiv - Cell Biology 2020Quote: ... Transcription reactions were treated with RNase-free DNaseI (NEB) to digest the DNA template at 37°C for 1 hour ...
-
bioRxiv - Neuroscience 2021Quote: ... DNA templates were removed with RNase-free DNaseI (NEB), and RNAs were poly-adenylated with E ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 60 U/ml DNaseI (RNase-free, NEB, M0303L) were added and the organoids were triturated gently with a P1000 pipette with a wide-bore tip ...
-
bioRxiv - Genetics 2020Quote: 300 intestinal stem and Paneth cells were sorted into 2 μl of nuclease free water with 0.2% Triton-X 100 and 4 U murine RNase Inhibitor (NEB). RNA was reverse transcribed (Invitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: ... the RNA was resuspended in an appropriate volume of RNase-free water supplemented with RNA inhibitors (New England Biolabs). RNA samples were stored at -80°C until further use ...
-
bioRxiv - Microbiology 2024Quote: The extracted RNAs from the BCoV-13 were treated with DNase I (RNase-free) (New England BioLabs; Lot. # 10213692) following manufacturer instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNase I treatment was performed to denaturalize the genomic DNA in the cells using 20U DNase I for 40s per coverslip (NEB; DNase I (RNase-free), M0303S) ...
-
A small molecule reveals role of insulin receptor-insulin like growth factor-1 receptor heterodimersbioRxiv - Cell Biology 2021Quote: ... cDNA samples were diluted in Nuclease-free water (NEB) before use in qPCR reactions ...
-
bioRxiv - Physiology 2021Quote: ... samples were resuspended in RNAse-free water and ligated to a 5’-adenylated DNA adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′ (M0373, New England Biolabs), for 3 hours at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 µg of RNA was treated with DNase (DNAse I RNas-free, NEB) for 10-15 minutes at 37 °C ...