Labshake search
Citations for New England Biolabs :
51 - 100 of 1294 citations for Adenovirus Type 3 Particles Wild type since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... The genomic region around the miossa20 allele was amplified for 35 cycles using 57°C for annealing and identified by restriction enzyme digestion of the wild-type allele with BsaWI for 1 hour (New England BioLabs). The genomic region surrounding the spo11uc73allele was amplified for 35 cycles with an annealing temperature of 57°C and products were resolved without digestion48 ...
-
bioRxiv - Genomics 2024Quote: ... and the wild-type (USH2A:c.7595-2144A) minigene plasmids were generated by Q5® High-Fidelity DNA Polymerase (New Englands Biolabs) amplification of the target USH2A region using gDNA of a human heterozygous USH2A:c.7595-2144A/G patient and subsequent cloning into the pSPL3 backbone vector by NEBuilder® HiFi DNA Assembly Cloning Kit (New England Biolabs) ...
-
bioRxiv - Plant Biology 2024Quote: ... Nucleotide changes leading to amino acid substitutions for Pic3 and Pic12 were first created in pENTR/D-TOPO (which contained wild-type Pic3 or Pic12) vectors by using the Q5 site-directed mutagenesis kit (New England Biolabs) with specific primers (Supplemental Table S4) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... This point mutation was corrected back to wild type by site-directed mutagenesis using Q5® Hot Start High-Fidelity DNA Polymerase (New England Biolabs) and primers ...
-
bioRxiv - Developmental Biology 2024Quote: ... The genomic region around rbpms2aae30 was amplified for 35 cycles with an annealing temperature of 60°C and the wild-type allele was digested with HaeIII for 1 hour (New England Biolabs, R0108S)2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The surrounding tsc2vu242 genomic region was amplified for 35 cycles with an annealing temperature of 57°C and the wild-type allele was digested with HpyCH4IV for 1 hour (New England Biolabs, R0169S). Undigested and digested products were resolved in a 3% Metaphor 1:1 (Lonza)/agarose gel (Invitrogen ...
-
bioRxiv - Systems Biology 2023Quote: ... five reactions each with 250 fmol of the construct carrying the mutant fragment or the original wild-type pNES-EGFP-C1-PH-ARNO(I303E)x2 construct were digested with 20 U each of BamHI-HF (NEB #R3136S) and HindIII-HF (NEB #R3104S) ...
-
bioRxiv - Microbiology 2024Quote: ... acidocaldarius DSM 639 wild type using the primers (Eurofins Genomics) listed in supplementary Table 4 employing the Q5 polymerase (NEB, USA) following the manufacturers’ instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Type IIs RE (0.5 μl, NEB), vector backbone and inserts were combined to make 10 μl ...
-
bioRxiv - Genomics 2022Quote: ... wild-type and mutant NEAT1 RNA fragments were transcribed in vitro using HiScribe™ T7 High Yield RNA Synthesis Kit (NEB, #E2040S) and labelled with Biotin using Biotin RNA Labelling Mix (Roche ...
-
bioRxiv - Neuroscience 2019Quote: The sequence encoding wild-type PlexB (Joo et al., 2013) was amplified by Q5 hot-start high-fidelity DNA polymerase (New England Biolabs, Ipswich, MA, USA) and assembled into a pUAST-attB vector (Li et al. ...
-
bioRxiv - Biophysics 2022Quote: ... type IIS enzymes (BsaI, New England Biolabs #R3733 ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNAse type IV (New England Biolabs/ Bioconcept) in DMEM/F12 (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... type IIS restriction enzyme SapI (New England Biolabs), which recognizes asymmetric DNA sequences and cleave outsides their 5’-GCTCTTCN↓NNN -3’ recognition site ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5’ and 3’ flanking sequences containing recognition sites for the Type II restriction enzyme BsaI-HF®v2 (NEB, R3733) were added to each IUPAC DNA block ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Type IIS assembly with BsmbI (New England Biolabs, MA, USA) and annealed oligo cloning ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and sRNA plasmids using BsaI Type IIS Enzyme (New England Biolabs) and transformed into E ...
-
bioRxiv - Neuroscience 2020Quote: ... Golden Gate Assembly protocol was applied with type IIS endonuclease Esp3I (NEB). The product was transformed into competent E ...
-
bioRxiv - Immunology 2023Quote: ... standard restriction cloning using the Type IIS restriction enzyme BsmBI-v2 (NEB) was employed to insert the leader peptides and variable regions into pVITRO1 (mouse IgG1 κ) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 10,000 units Type IIs restriction enzymes (T7 DNA ligase, Esp31/BsaI-v2, NEB), and 1 μL T4 DNA ligase (NEB ...
-
bioRxiv - Synthetic Biology 2023Quote: ... In the second Type IIS DNA assembly reaction using BbsI (New England Biolabs), these transcriptional unit constructs were assembled into the backbone plasmid pML3001 (Lebovich and Andrews 2022 ...
-
bioRxiv - Molecular Biology 2021Quote: pUC19 was digested using thirteen commercially available Type II restriction enzymes (New England Biolabs). For BamHI ...
-
bioRxiv - Bioengineering 2022Quote: ... The template DNA was removed by using DpnI type IIM restriction enzyme (NEB, USA) at 37°C (1 – 2 h ...
-
bioRxiv - Biophysics 2022Quote: ... type IIS enzymes (BsaI, New England Biolabs #R3733, and BsmBI, New England Biolabs #R0739) were used to iteratively concatenate sequence modules ...
-
bioRxiv - Biophysics 2023Quote: ... the use of a Type IIs restriction enzyme (BsaI-HF-v2, New England Biolabs) that produces unique 4 bp sticky ends ensures that the three fragments are oriented in a unique way.
-
bioRxiv - Cell Biology 2023Quote: ... the adenovirus expression constructs were linearized using PacI restriction enzyme (NEB) and transfected into HEK293A cells cultured in 6-well plates using Lipofectamine 2,000 to produce the initial adenovirus ...
-
bioRxiv - Biochemistry 2019Quote: ... This assembly was performed using a Type IIs restriction enzyme BsaI (New England Biolabs # R3535) and T4 DNA ligase (New England Biolabs # M0202 ...
-
bioRxiv - Molecular Biology 2022Quote: ... the protein coding sequences were ordered synthetically with Part 3b type BsaI overhangs (NEB R3733) and cloned into the entry vector with BsmBI (NEB R0739) ...
-
bioRxiv - Synthetic Biology 2024Quote: pSpy0C2 was cloned using Golden Gate Assembly using the type II restriction enzyme Esp3I (NEB). The MCS-cat fragment and the pUC origin were amplified using OLEC10311/10312 from pSpy1C and OLEC10315/10316 from pUC19-mKate2∼ssrA ...
-
bioRxiv - Genomics 2021Quote: ... gDNA was digested with the CspCI Type IIB restriction enzyme (IIB-REase - New England BioLabs, Inc.) which has shown to yield a high marker density in triatomine65 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Golden gate (Type-IIS) cloning was conducted using chemically competent Escherichia coli DH5α cells (NEB, C2987H). Construction of destination vectors with the toxic selection marker ccdB was done with chemically competent One Shot ccdB Survival 2 T1R E ...
-
bioRxiv - Plant Biology 2019Quote: ... the sgRNA vectors were digested with the type IIS restriction enzyme BsaI (New England Biolabs, cat#R0535S) and dephosphorylated with Calf Intestinal Alkaline Phosphatase (Takara ...
-
bioRxiv - Microbiology 2019Quote: ... The resulting plasmid pFN_7_37_2k_kanRn was generated by the type IIS restriction enzyme BbsI and T4 DNA ligase (both NEB, USA). Another version of kanR with slightly different 5’ and 3’UTR was generated by PCR using the primer pair F13 ...
-
bioRxiv - Immunology 2023Quote: ... we pooled all the eBlocks at equal molar ratio and used PaqCI Type IIs restriction enzyme (NEB), NEBridge Ligase Master Mix (NEB) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and ligated into the BioID plasmid using type II restriction enzymes BamHI and XhoI (New England BioLabs) and T4 DNA ligase ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and about 200 ng of DNA was digested with the type II b enzyme BcgI (New England Biolabs). This enzyme cuts both upstream and downstream of the 6 bp recognition site ...
-
bioRxiv - Neuroscience 2023Quote: Specificity of anti-H3K9Me3 was tested against two types of substrates: recombinant histone H3 (New England BioLabs, M2507S), which lacked methylation ...
-
bioRxiv - Bioengineering 2023Quote: ... cloning was achieved via one-pot restriction-ligation reactions with type IIS restriction enzymes (NEB or Thermo Scientific) and T4 DNA ligase (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... using a golden gate assembly strategy (19) and a type-II restriction SapI enzyme (New England Biolabs, R0569). A similar cloning strategy was used to build vectors bearing a JcDV viral genomes with fragments of cellular genes (~160 nucleotides ...
-
bioRxiv - Immunology 2023Quote: ... We pooled the second set of eBlocks at equal molar ratio and used Esp3I Type IIs restriction enzyme (NEB), NEBridge Ligase Master Mix ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and terminator) was assembled in one-pot Type IIS DNA assembly reaction using BsaI-HFv2 (New England Biolabs, NEB). Transcription units to assay the sensor output contained the PQS promoter expressing the gfp gene ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and terminator) was assembled in one-pot Type IIS DNA assembly reaction using BsaI-HFv2 (New England Biolabs, NEB). Transcription units to assay the sensor output contained the PQS promoter expressing the gfp gene ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 μL of entry vector (backbone), 0.5 μL of type IIs restriction enzyme (BsaI, BsmBI or BbsI-HF) (NEB), 0.5 μL of T4 DNA Ligase (NEB) ...
-
Calibrated feedback illumination for precise conventional fluorescence and PALM imaging applicationsbioRxiv - Biophysics 2019Quote: ... Wild-type ADE2 was amplified from genomic DNA, RB201 (W303 MATa, trp1, leu2, ura3, his3, can1R, ADE2) with Phusion PCR (NEB) using the forward primer (ATGGATTCTAGAACAGTTGGTATATTGGGAGGGGGACAA ...
-
bioRxiv - Biophysics 2021Quote: Wild-type MukB was 6×His-tagged at the C-terminus and was expressed from plasmid Pet21 in C3013I cells (NEB). For Immobilized His6-tagged MukB ...
-
bioRxiv - Cell Biology 2020Quote: ... CASP1 and CASP4 CDS were amplified from the obtained library and cloned into the pMSCV-puro vectors The caspase-4 catalytically dead C258A pMSCV-puro vector was generated from the wild-type pMSCV-puro-CASP4 through site-directed mutagenesis by PCR using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). The CASP4 and GSDMD-targeting lentiviral vectors (pGIPZ ...
-
bioRxiv - Biophysics 2021Quote: ... The 5’-terminus was capped with a type I 7-methylguanosine cap (m7G) using the Vaccinia Capping System (NEB, M2080S) and 2’-O-methyltransferase (NEB ...
-
bioRxiv - Bioengineering 2020Quote: In-vitro digestion reactions were carried out with three different types of the Cas12a family (LbCas12a, AsCas12a, and FnCas12a were purchased from New England Biolabs Inc. ...
-
bioRxiv - Biochemistry 2021Quote: ... The insert is fused during cloning through an overlapping proline-encoding CCG codon introduced by reverse and forward primers at the 3’- and 5’-end of the sybodies and MBP respectively and released by digestion with the Type IIS restriction enzyme SapI (NEB). The second proline of the linker is encoded in the forward primer of the MBP (3’ of the overlapping CCG codon ...
-
bioRxiv - Biophysics 2022Quote: ... the assembled sequences were transferred to the target plasmids (WT, MUT) by using a different set of type IIS enzymes (BbvI, New England Biolabs #R0173 ...