Labshake search
Citations for New England Biolabs :
51 - 100 of 5969 citations for 8 4 ethoxy 3 methoxyphenyl 1 5 diazabicyclo 3.2.1 octane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: ... forward (5’-AAGCCAAGTCTGCATGAGTA-3’) and reverse (5’-TAAATGTGCCACTGACTAAAT-3’) followed by a restriction enzyme digestion with Sau96I (New England Biolabs) at 37ºC for 2-3 hours ...
-
bioRxiv - Neuroscience 2019Quote: ... encoding full length Ppp3cc was amplified with primers 5’- AGATTACGCTATCTGTACAGAATTCACCATGTCCGTGAGGCGC-3’ and 5’-GGCCGCTAGCCCGGGTACCGAATTCTTACAGGGCTTTCTTTCCATGGTC-3’ and inserted into pCAG-HA vector using NEB Builder (NEB).
-
bioRxiv - Evolutionary Biology 2019Quote: ... DNA for the Ty1 probe was amplified with primers 5’-TGGTAGCGCCTGTGCTTCGGTTAC-3’ and 5’-CATGTTTCCTCGAGTTAGTGAGCCCTGGCTGTTTCG-3’ and Phusion DNA polymerase (New England Biolabs). DNA for the Ty2 probe was generated with primers 5’-TGGTAGCGCCTATGCTTCGGTTAC-3’ and 5’-GCAATATTGTGAGCTTTTGCTGCTCTTGG-3’ ...
-
bioRxiv - Developmental Biology 2019Quote: ... the PCR products were amplified further with the primers 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTCA-3’ and 5’-GGGGACC ACTTTGTACAAGAAAGCTGGGTC-3’ and Phusion polymerase (New England Biolabs) to add attB adapter sequences ...
-
bioRxiv - Systems Biology 2019Quote: ... and C-terminal AD was PCR amplified from pGADCg101 using forward primer AP36 (5’ GAAGGCTTTAATTTGCAAAGCTCGGGATCCGGGCCCCCCCTCGAGATCCGcatctattgaagtaat aataggcgcatg 3’) and reverse primer AP37 (5’ CAACCTTGATTGGAGACTTGACCAAACCTCTGGCGAAGAAGTCCAAAGCTctgaataagccctcgt aatatattttcatg 3’) and cloned into EcoRI (New England Biolabs, NEB) and SalI (NEB ...
-
bioRxiv - Microbiology 2021Quote: 16S rRNA gene regions V3-V4 were amplified with primers 314F (5’-CCTAYGGGRBGCASCAG-’3) and 806R (5’-GGACTACNNGGGTATCTAAT-3’) with Phusion High-Fidelity PCR Master mix (New England Biolabs) and amplified products were verified using Agilent 5400 Fragment analyser ...
-
bioRxiv - Cell Biology 2022Quote: ... It was followed by a second In-Fusion HD cloning of a polymerase chain reaction using 5’-GAAGGGGATCCACCGATGGTGAGCAAGGGCGAGG-3’ / 5’-TTAGTAGCTCTAGACTTGTACAGCTCGTCCATGCC-3’ (mScarlet insert) using BamHI and XbaI (New England Biolabs).
-
Neural mechanisms underlying uninstructed orofacial movements during reward-based learning behaviorsbioRxiv - Neuroscience 2023Quote: ... and a pair of oligonucleotides (Forward, 5’-CACCGTCAATAATGAGGTGGTCCGA-3’; Reverse, 5’-AAACTCGGACCACCTCATTATTGAC-3’) was ligated with T4 DNA Ligase (M0202, New England BioLabs).
-
bioRxiv - Bioengineering 2023Quote: ... The β2-tubulin locus was amplified with the 1114A.S43 (5’ GAGAGCAACACTCGTGCG 3’) and 1114A.S44 (5’CAGGGTGGCATTGTACG 3’) primers and the amplicon was digested with Fspl (NEB cat#R0135S) or Ddel (NEB cat#R0175S ...
-
bioRxiv - Bioengineering 2023Quote: The barcoded FXN region was recovered from the resulting cDNA library or DNA using primers of 5’-TGGACCTAAGCGTTATGACTGGAC-3’ and 5’-GGAGCAACATAGTTAAGAATACCAGTCAATC-3’ and PCR was performed using Q5 2x Master Mix (New England BioLabs) at 25 cycles of 98°C for 10s ...
-
bioRxiv - Cancer Biology 2023Quote: ... Half-hairpin sequences were amplified from the genomic DNA (common forward primers 5′- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTCTTGTGGAAAGGACGA-3′ and reverse primer 5′-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCTACTATTCTTTCCCCTGCACTGT-3′) using Q5 High-Fidelity 2x Master Mix (NEB). PCR reactions were cleaned up using Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Developmental Biology 2023Quote: The myo1g ORF was amplified from mixed stage pool of cDNAs using primers 5’-GATCCCATCGATTCGATGGCGGAGCTGGAGGGCTTG-3’ and 5’-AGGCTCGAGAGGCCTTACTGGGGCAGGAGTAAGG-3’ and cloned into the pCS2+ vector using Gibson assembly mix (NEB). Bold letters in the primer sequences indicate Gibson overhangs that are also present in the pCS2+ sequence ...
-
bioRxiv - Molecular Biology 2024Quote: ... The CHD4-GFP mutant was cloned with selective primers (fwd, 5’-GGATGCTACAGGTGGAACCCTGCACCCCTA-3’; rev, 5’-GCCCAGGCCCGACGCCAT-3’) and a Q5 site-directed mutagenesis kit (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNA resistant mCherry-ALG-2 was created by mutagenesis (primers sequences 5’-ATTTCGATGTTTGACCGTGAGAAC-3’, 5’-AATGGACCTGACAGTCACTGGATTAAA-3’) using a Q5 Site-Directed Mutagenesis Kit (E0554S, NEB). The plasmid encoding IST1-GFP is as described (63 ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
A universal fluorescence-based toolkit for real-time quantification of DNA and RNA nuclease activitybioRxiv - Biochemistry 2019Quote: ... Klenow Fragment (3’ → 5’ exo-; New England Biolabs), RNase A (Thermo Fisher ...
-
bioRxiv - Genomics 2021Quote: ... using Large Klenow fragment 3’-5’ exo- (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... by using Klenow Fragment (3′→5′ exo-) (NEB) for 30 min at 37 °C and purified by QIAquick PCR Purification Kit ...
-
Autorepression of Yeast Hsp70 co-chaperones by intramolecular interactions involving their J-domainsbioRxiv - Biochemistry 2024Quote: ... SIS1VR 5’- CCAATCTGTTCGCGGTGAGCCTCA-3’) by Gibson Assembly (NEB). All constructs were confirmed by sequencing.
-
bioRxiv - Microbiology 2021Quote: ... Index Primers Sets 3 and 4 (New England Biolabs). Libraries were sequenced on an Ilumina NextSeq500 ...
-
bioRxiv - Genetics 2021Quote: ... pUASTattB-3xHA::amxFL described above was used as a template to amplify and add appropriate homology arms to the SS-3xHA::Amx DNA sequence with the primers 5’- CCCCGCTCTATCTGACCAAAGCCACCATGAGGCTCCAACGAC-3’ and 5’- AAAACTAAACTAAGAACGGACTACTATATGTAAAGTGAGCCATCCGC-3’ using Q5® High-Fidelity 2X Master Mix (M0492S, NEB). The section of pattB-amx plasmid containing the amx regulatory elements was linearized by PCR using Q5 polymerase and primers 5’- CGTTGGAGCCTCATGGTGGCTTTGGTCAGATAGAGCG-3’ and 5’- GCTCACTTTACATATAGTAGTCCGTTCTTAGTTTAGTTTTACAGGGGT-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... Subclones were screen for correct targeting by PCR amplification and restriction enzyme digestion (Forward: 5’-GTAGTACCATGCCGAAAGCAC-3’, Reverse: 5’-GGAACCACCTATCTGTTATCC-3’, Restriction Enzyme: TseI, NEB R0591). Knockout lines were identified by Sanger sequencing (Sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... Subclones were screen for correct targeting by PCR amplification and restriction enzyme digestion (Forward: 5’-TGGCGCTAGTATTTGAAGCA-3’, Reverse: 5’-ACTTGGGATCCAATTCTGTCTACT-3’, Restriction Enzyme: EcoRI, NEB R3101). Specific mutations were identified by Sanger sequencing (Sequencing ...
-
bioRxiv - Microbiology 2019Quote: ... Zip codes were amplified from 100 ng of genomic DNA using primers flanking the zip code region (primers: 5‘-NNACGAAGACAAGATATCCTTGATC-3’ and 5’-NNTGTGTGGTAGATCCACATCG-3’) using Phusion® High-Fidelity DNA Polymerase (New England Biolabs) in HF Buffer ...
-
bioRxiv - Cell Biology 2019Quote: A PCR amplified genomic DNA fragment using forward primer 5’-CGATCCTCTTGCCTCCATGT-3’ and reverse primer 5’-CCAGCTGTTCGCGTTCATA-3’ was digested with XmnI (NEB; R0194L). Undigested and digested samples were proceeded for electrophoresis using 2% agarose gels.
-
bioRxiv - Genetics 2020Quote: ... 5’-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCACTGT-3’ (8bp Barcode) and P5 overhang: 5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTTGTGGAAAGGACGAAACACCG-3’ using Q5 Hot Start High-Fidelity polymerase (NEB, #M0494S) for 21-24 cycles ...
-
bioRxiv - Systems Biology 2019Quote: ... and C-terminal AD was PCR amplified from pGADCg101 using forward primer AP36 (5’ GAAGGCTTTAATTTGCAAAGCTCGGGATCCGGGCCCCCCCTCGAGATCCGcatctattgaagtaat aataggcgcatg 3’) and reverse primer AP37 (5’ CAACCTTGATTGGAGACTTGACCAAACCTCTGGCGAAGAAGTCCAAAGCTctgaataagccctcgt aatatattttcatg 3’) and cloned into EcoRI (New England Biolabs, NEB) and SalI (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... E1E2 sequence was amplified via PCR from pcDNA E1E2 vector using primers (forward 5’ CGAAGCTTGCATGGGTTGCTCTTTC 3’. and reverse 5’ CAGAATTCCCGCCTCCGC 3’) the product was subsequently digested with HindIII and EcoRI (NEB, USA) and ligated into pEGFP-N1 to create a E1E2-EGFP fusion construct with EGFP at the C-terminal end.
-
bioRxiv - Microbiology 2022Quote: Libraries cloned in the pYD1 vector were amplified using forward 5’-TTAAGCTTCTGCAGGCTAGTGGTG-3’ and reverse 5’-CACTGTTGTTATCAGATCAGCGGG-3’ primers with Taq DNA Polymerase and ThermoPol Buffer (New England Biolabs Ltd) for 16 cycles of 95°C for 30 sec ...
-
bioRxiv - Genomics 2023Quote: ... using 0.3 μM of dual-indices primers (forward: 5’:AATGATACGGCGACCACCGAGATCTACACCTCCAAGTTCACACTC TTTCCCTACACGACGCTCTTCCGATCT-3’; reverse 5’-CAAGCAGAAGACGGCATACGAG ATCGAAGTATACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTAGCAAACTGGGG CACAAGC-3’) and amplified using Q5 2X master mix (NEB #M0541S) according to the following protocol ...
-
bioRxiv - Genetics 2022Quote: ... locus using the primers ubb polyA fw: 5’-TAGAACCGACAGTCTTAGGGATGG-3’ and ubb polyA rv: 5’-GAATTCATTGCCATCAAGTGTTAGC-3’ with Phusion High Fidelity DNA Polymerase (NEB M0530S), subcloned into the Zero Blunt TOPO PCR Cloning vector (Invitrogen K283020) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The bead slurry was directly treated with 3 µL Klenow (3’→5’ exo-) (NEB) in 50 µL NEB Buffer #2 with 0.2 mM ATP at 37 °C for 30 min to add 3’ overhangs to DNA ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 5 μl of the resulting amplicon were diluted 1:4 in 1x buffer 2 (NEB), followed by denaturation and re-annealing in a nexus GSX1 Mastercycler (Eppendorf ...
-
bioRxiv - Genomics 2020Quote: ... 1 μL of 10 mM dATP and 15 units of Klenow 3’ → 5’ exo- (NEB M0212L) was added to blunted ends and incubated at 37°C for 30 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1 µM gRNA pool (3 gRNAs in total) in 4× Cas9 Reaction Buffer (New England Biolabs) at 25°C for 10 min in a 5 µl reaction volume ...
-
bioRxiv - Genomics 2021Quote: The supernatant was magnetically removed and the beads were resuspended in 20 µl of L3 DNA linker ligation mixture (8 µl water, 5 µl 4X ligation buffer, 1 µl RNA ligase [New England Biolabs] ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was PCR amplified using primers: 5’-gaagaaatgaatttgccagg-3’ and 5’-ctcatgttcttcttgggc-3’ and Phusion DNA Polymerase Master mix (New England Biolabs, Ipswich, MA). DNA was sent for Sanger Sequencing to check for reversion mutations.
-
bioRxiv - Plant Biology 2022Quote: The pVecBar-Rht13 construct contained a 6,998 bp fragment including 2,532 bp upstream and 450 bp downstream regions amplified from Magnif mutant genomic DNA using primers Rht13-NotF2 (5’ AATGCGGCCGCAATCGATAGGAGAGCTGCGTCTGTGTG 3’) and Rht13-AscR2 (5’ TGCGTACGGCGCGCCGAGAGTCGCCTTGCCAGTTC 3’) with Phusion® High-Fidelity DNA Polymerase (NEB, USA). pVecBarIII is a derivative of pWBvec8 (Wang et al. ...
-
bioRxiv - Genetics 2023Quote: The yeast plasmids recovered after thermoselection were subject to a shortened PCR with 15 cycles with oligonucleotide pairs oWS1408 (5°-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCAGCATATAATCCCTGCTTTA-3°) and oWS1409 (5°-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCCAGGGGTGGTGCAAACTATG-3°) using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA) to attach overhang sequences ...
-
bioRxiv - Biochemistry 2023Quote: ... and “frq segment 4F” (5’-CACCGATCTTTCAGGAGACCCTG-3’) and “frq segment 4R” (5’-CACTCAGGTC TCAATGGTGA TG-3’) pair with pCB05 digested with FseI (NEB, Catalog # R0588S) and MluI (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... “frq segment 3F” (5’-GTCGCACTGGTAACAACACCTC-3’) and “frq segment 3R” (5’-CAGCACATGTTCAACTTCATCAC-3’) were designed for pCB05 digested with NruI (NEB, Catalog # R0192S) and FseI (NEB ...
-
bioRxiv - Genomics 2021Quote: ... End fill-in and A-tailing were performed by addition of Klenow Fragment 3’ --> 5’ exo-(Enzymatics) and dNTP mix (10 mM dATP, 1 mM dCTP, 1 mM dGTP New England Biolabs). After ligation to methylated Illumina TruSeq LT v2 adaptors using T4 DNA Ligase rapid (Enzymatics) ...
-
bioRxiv - Biochemistry 2023Quote: ... were ligated to 50 pmol RNA oligonucleotide “20.25” (5’-UCG AAG UAU UCC GCG UAC GU-3’, Dharmacon) with 1 µL T4 RNA ligase 1 (NEB, #M0204S) for 1 h at 16 °C in 15% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μl 4× Template Switching RT buffer (NEB), 1 µl of 75 μM T7-TSO (5’-/5Biosg/ACTCTAATACGACTCACTATAGGGAGAGGGCrGrGrG-3’) ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.5 μl Klenow Fragment (3’->5’ exo-) (NEB, cat#M0212S, 5 U/μl) per amplicon pool reaction ...
-
bioRxiv - Molecular Biology 2020Quote: ... by Klenow fragment (3’→5’ exo-) (NEB, Ipswich, MA) for 30 min at 37 °C ...
-
Removal of Spo11 from meiotic DNA breaks in vitro but not in vivo by Tyrosyl DNA Phosphodiesterase 2bioRxiv - Molecular Biology 2019Quote: ... 15 units of Klenow (3′→5 ′ exo–) polymerase (NEB) with 66 nM dNTPs for 30 minutes at 30°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.15 U Klenow Fragment (3’→5’ exo-) (NEB) in 1X NEBuffer 2 at 37°C for 30 minutes (cite) ...