Labshake search
Citations for New England Biolabs :
51 - 100 of 4783 citations for 8 4 Chlorophenylthio 2' O methyladenosine 3' 5' cyclic monophosphate sodium salt since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... and immunoprecipitation was performed using the EpiMark N6-methyladenosine Enrichment Kit (NEB) as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... with 3’-O-Me-m7GpppG anti-reverse cap analog (ARCA) or ApppG cap (NEB) added at 8:1 to GTP for a capping efficiency of ∼90% ...
-
bioRxiv - Developmental Biology 2021Quote: ... custom NTP mix was prepared with 3’-O-Me-m7G cap analogue (60mM, NEB), GTP (75mM ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Biochemistry 2019Quote: ... 4 μg of plasmid was treated with 1U Klenow Fragment (3’ to 5’ exo-, NEB) for 10 min at 37°C to fill any remaining gapped plasmid 12 ...
-
bioRxiv - Genomics 2020Quote: ... m6A-immunoprecipitaion was performed using the EpiMark N6-Methyladenosine Enrichment Kit (NEB E1610S), followed by library preparation using the SMARTer Stranded Total RNA-seq kit v2 (Takara ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adenylation reactions were conducted by adding 5 μL of NEB buffer 2 (NEB), 1 μL 10 mM dATP ...
-
bioRxiv - Genetics 2022Quote: ... The resulting monophosphorylated RNAs were ligated to the 3’ adaptor (5’rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’, IDT) using T4 RNA ligase 2 in the presence of 25% PEG8000 (NEB) at 15 °C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1 ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Biophysics 2019Quote: ... were bound to the beads in the presence of 1 µM DNA oligonucleotide 5’-TCTCCTCCGAAGAAA-3’ (targeting DNA) and 2 µL RNase H (5 units/µL, NEB) were added to the reaction ...
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... and ligated to hairpin adaptor 2 (ENDseq-adaptor-2, 5′-Phos-GATCGGAAGAGCACACGTCUUUUUUUUAGACGTGTGCTCTTCCGATC*T-3′ [*phosphorothioate bond]) (Quick ligation kit, NEB). To prepare libraries for sequencing ...
-
bioRxiv - Genomics 2019Quote: ... 3’-adenylation (Klenow Fragment 3’ to 5’ exo-, NEB), and ligation of indexed sequencing adaptors (Quick Ligation kit ...
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Cell Biology 2020Quote: ... and O-glycosidase (NEB). Sperm cells were washed with 1x reaction buffer for each enzyme by centrifugation at 800 x g for 3 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Free nucleotides were purchased as 100mM stocks of dATP or dUTP as sodium salts in ultrapure water (NEB) and stored at -20°C ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 5 μl of the resulting amplicon were diluted 1:4 in 1x buffer 2 (NEB), followed by denaturation and re-annealing in a nexus GSX1 Mastercycler (Eppendorf ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ triphosphates on the synthesis products were converted into 5’ monophosphates: samples were treated with recombinant shrimp alkaline phosphatase (NEB) (10 µl reaction in 1× NEB buffer 2.1, 37°C 30 min, 65°C 5 min), these reactions were made up to 15 µl including 0.5 µl 10× NEB 2.1 ...
-
bioRxiv - Genomics 2020Quote: ... 3 mM DTT 8 μl Large Klenow Fragment (NEB, #M0210L) and 2 μl T4 PNK (NEB ...
-
bioRxiv - Genomics 2023Quote: ... 3 µL 10x NEBuffer 4 (NEB), 3 µL of 1 mM each dATP/ddCTP/ddGTP/ddTTP (dATP/ddBTP ...
-
bioRxiv - Immunology 2020Quote: ... m6A-positive and m6A-negative control oligonucleotides (EpiMark N6-Methyladenosine Enrichment Kit, New England Biolabs) were spiked into total RNA prior to immunoprecipitation ...
-
bioRxiv - Immunology 2020Quote: ... to generate Cap 0 and in some cases also the Vaccinia 2’ O methyltransferase (NEB) to generate Cap 1 ...
-
bioRxiv - Microbiology 2022Quote: ... a custom 3’ adapter (5’-rAppCTGTAGGCACCATCAAT–NH2-3’, NEB, S1315S) was ligated to all RNAs ...
-
bioRxiv - Microbiology 2020Quote: ... and 5 mM sodium fluoride (New England Biolabs, Ipswich, MA) and 1 mM sodium orthovanadate (New England Biolabs ...
-
bioRxiv - Biochemistry 2021Quote: ... libraries were generated using 5 μl of the purified RT reaction product and 4-8 cycles of PCR with Q5 high fidelity polymerase (NEB, M0491S). PCR reaction products were column purified ...
-
bioRxiv - Molecular Biology 2024Quote: ... 8 μl 5 U/μL Klenow Fragment (NEB, M0210S) and 2 μl T4 PNK (NEB ...
-
bioRxiv - Systems Biology 2021Quote: ... the purified DNAs were annealed using random nonamer primers with a 5′-biotin tag (5′-Biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′) in the presence of Klenow fragments (3′-5′ exo-, New England Biolabs). Then ...
-
bioRxiv - Cancer Biology 2023Quote: ... Pu TKamplicon (5’-CTGTTTTCATTCTGCCTTTTGACCATAGAGCCCACCGCATCC-3’ and 5’-GCCAACAAAGAAAGCCTCACTACC GGGTAGGGGAGGCG -3) and Gibson Assembly master mix (NEB) following the manufacturer’s guidelines.
-
bioRxiv - Biochemistry 2023Quote: Transcription reactions were prepared at room temperature in 20 µL transcription buffer (40 µM Tris-HCl pH 8, 5 mM DTT, 10 mM MgCl2) with 2 mM NTP’s (NEB, N0450S) and 40 U/µL RNasin™ Plus (Promega ...
-
bioRxiv - Bioengineering 2021Quote: 3 μL of 5′-deadenylase (NEB) were added to ligation reaction,
-
bioRxiv - Genomics 2023Quote: ... Klenow Fragment (3’→5’ exo-) (NEB) was diluted in 1X NEBuffer 2 to a final concentration of 2 U/μL ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 units of Klenow Fragment (3’à 5’ exo-, NEB), CutSmart buffer (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µl of Klenow Fragment (3′→5′ exo-, NEB, M0212S), 3 µl of T4 polynucleotide kinase (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... Purified RNA then was pulldown using m6A specific antibody using EpiMark N6-methyladenosine enrichment kit(NEB). RNA was converted into cDNA using random hexamer primers and Revert aid RT (Invitrogen) ...
-
bioRxiv - Molecular Biology 2022Quote: ... One round of m6A immunoprecipitation was performed using the EpiMark N6-Methyladenosine Enrichment Kit (NEB #E1610S) and protocol ...
-
bioRxiv - Molecular Biology 2023Quote: 7.5ug of total RNA was immunoprecipitated for m6A with EpiMark® N6-Methyladenosine Enrichment Kit (NEB) following the manufacture protocol with 10% of the sample RNA taken as input prior to the pulldown ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
bioRxiv - Molecular Biology 2021Quote: ... O-glycosidase (New England Biolabs), neuraminidase (New England Biolabs ...
-
bioRxiv - Microbiology 2022Quote: ... For O-glycosidase (NEB P0733S) treatment ...
-
bioRxiv - Molecular Biology 2023Quote: ... the enzymatic activity of the commerically availablale recombinant vaccinia virus methyltransferase mRNA 2’O-methyltransferase (NEB), abbreviated hereagter as VMTR1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads were treated with JET (12.5 nM d-o-p) and/or ScaI-HF (NEB, 5 U) for 15 minutes at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA (5 μg) was ligated to the RNA 3’ adaptor using T4 RNA Ligase 2 - truncated (NEB), in the presence of RNase Inhibitor (NEB) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µ l of Klenow Fragment (3’→5’ exo-, NEB, M0212S) 3µl of T4 Polynucleotide Kinase (NEB ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... with oligos 5’-GGTGGTTGCTCTTCCAACGCTGACGCTAAGGAGATTGTG-3’ and 5-GGTGGCATATGTTAGATGGTCATGCCGGAGG-3’ and cloned with SapI and NdeI into Tyb21 (NEB), giving pFW38 ...
-
bioRxiv - Cell Biology 2023Quote: ... m6A immunoprecipitation (m6A-IP) and library preparation were performed using the EpiMark N6-Methyladenosine enrichment kit (NEB). Input and RNA eluted from m6A-IP were used to generate the library using TruSeq stranded mRNA sample preparation kit (Illumina) ...