Labshake search
Citations for New England Biolabs :
51 - 100 of 1895 citations for 6 chloro 4 hydroxyquinoline 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Digest with 6 x loading dye (NEB) was run on a 1 % agarose gel at 100 V for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 6 U of Heparinase I (NEB) was added to the first strand cDNA synthesis mix ...
-
bioRxiv - Neuroscience 2021Quote: ... 6 μl BST LF polymerase (NEB M0275L), and 36 μl DEPC-treated H2O ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by PNGase A (NEB; pH 6). The released N-glycans were purified using initially a cation exchange material (Dowex AG50 H+ form ...
-
bioRxiv - Plant Biology 2024Quote: ... 6 µg of the commercial EngenCas9 (NEB) with 2 µg of the freshly synthetized SgRNA1 obtained with the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB) ...
-
bioRxiv - Bioengineering 2024Quote: ... 6 mM Magnesium Sulfate (MgSO4 – NEB #B1003), 1.4 mM deoxynucleotide (dNTP ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Evolutionary Biology 2019Quote: ... The resulting library was pooled into 12 separate 60 amino acid long sub-libraries (amino acids 1-60, 61-120 etc.) and combined via Gibson Assembly (NEB) with a linearized p414ADHΔter Hsp90 destination vector ...
-
bioRxiv - Microbiology 2020Quote: ... 3 mM MgCl2 (NEB), 0.24 mg.ml−1 BSA (Fermentas) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3 (NEB #E7710) were used to create unique identifiers for each cDNA library sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 µL MNase (NEB) was added to a clarified K562 lysate from ∼5 M cells and digested for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3’ NotI (NEB) before being tested by sequencing (Macrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
bioRxiv - Developmental Biology 2023Quote: ... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid expressing EBFP2-14-3-3 theta was created using HiFi Cloning (NEB) of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665) ...
-
bioRxiv - Immunology 2021Quote: ... 3’ loxP site and 3’ arm of homology) was linearized with NotI (NEB) and recombineered into RP24-227B3 BAC clone that was transformed into SW102 strain by electrophoration (186 ohms ...
-
bioRxiv - Microbiology 2020Quote: ... 6 µg of DNA was used for MmeI digestion in 200 µL (6 µg gDNA, 6 µL MmeI (2000 U/mL, NEB), 0.5 µL 32 mM S-adenosylmethionine ...
-
bioRxiv - Synthetic Biology 2022Quote: ... A fraction (6 μL) of the eluate was mixed with an equal volume of 6× purple gel loading dye (NEB) and loaded in 1% agarose gel with ethidium bromide ...
-
bioRxiv - Immunology 2023Quote: ... was biotinylated with sulfosuccinimidyl-6-[biotinamido]-6-hexanamido hexanoate (sulfo-NHS-LC-LC biotin; ThermoScientific) and coupled to streptavidin beads (New England Biolabs). Patient samples were incubated with RBD-coupled beads and excess sera washed off with PBS (Sigma) ...
-
bioRxiv - Genomics 2019Quote: ... and 6 µL Klenow (5 U/µL, NEB), and DNA blunting was carried out for 1 h at room temperature with shaking at 800 rpm ...
-
bioRxiv - Genomics 2019Quote: ... and 6 μl USER enzyme (New England Biolabs). The reaction was incubated at 37°C for three hours ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 6 μl 10mM ATP (New England Biolabs). Linear DNA was then digested by 30 minute incubation at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... and 6 μM of random hexamer primer (NEB). cDNA was amplified with Taq DNA polymerase (NEB ...
-
bioRxiv - Genetics 2020Quote: ... 6 μl 20 mg/ml BSA (NEB B9000S), and 5 μl of 400 U/μl T4 ligase (NEB M0202S/L) ...
-
bioRxiv - Microbiology 2022Quote: ... 6 U Bst 2.0 WarmStart DNA polymerase (NEB), and 2.25 U WarmStart® RTx Reverse Transcriptase (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 6 U/ml Thermolabile proteinase K (NEB). The barcoded PAAm beads were prepared for encapsulation as previously described (Zilionis et al. ...
-
bioRxiv - Microbiology 2023Quote: ... 6 µL of Proteinase K (New England Biolabs) was added to the cell resuspension ...
-
bioRxiv - Microbiology 2024Quote: ... 6 μl of 50% PEG 8000 (NEB B1004A), 40 units of Ribolock RNase inhibitor EO0382)] ...
-
bioRxiv - Microbiology 2023Quote: ... 4% DMSO (Biolabs), 200 nM of each primer kdpAB(37) ...
-
bioRxiv - Biochemistry 2023Quote: ... buffer 4 (NEB, identical composition to rCutsmart buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... gel extracted using Monarch Nucleic Acid Purification Kits (NEB) and submitted for Sanger Sequencing ...
-
bioRxiv - Systems Biology 2021Quote: Rho libraries were amplified using primers MO574 and MO575 (Supplementary file 6) for 6 cycles at an annealing temperature of 66C followed by 18 cycles with no annealing step (NEB Phusion) and then purified with the Monarch PCR kit (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The bead slurry was directly treated with 3 µL Klenow (3’→5’ exo-) (NEB) in 50 µL NEB Buffer #2 with 0.2 mM ATP at 37 °C for 30 min to add 3’ overhangs to DNA ...
-
bioRxiv - Plant Biology 2019Quote: ... 3 µl USER Enzyme (NEB) was used with size-selected ...
-
bioRxiv - Biophysics 2020Quote: ... and 3-biotin-GTP (NEB) and purified using MEGAclear ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 3 units of DNaseI (NEB) were added and the mixture was incubated at 37°C for 1 h.
-
bioRxiv - Microbiology 2020Quote: ... 3) NEB LongAmp (NEB M0287) and 4 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3□μf USER Enzyme (NEB) was then used with the size-selected ...
-
bioRxiv - Genetics 2020Quote: ... 3 μL exonuclease buffer (NEB) and 4 μL nuclease-free water (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 µL XmaI (NEB R0180S) was added to fragment chromatin ...
-
bioRxiv - Genomics 2022Quote: ... 3 μl HinP1I (NEB R0124S), 3 μl DdeI (NEB R0175L) ...
-
bioRxiv - Genomics 2022Quote: ... 3 μl CviAII (NEB R0640L), 3 μl FspBI (ThermoFisher ER1762) ...
-
bioRxiv - Genomics 2022Quote: ... 3 μl DdeI (NEB R0175L), 3 μl CviAII (NEB R0640L) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 µL Rnl2KQ (NEB M0373S), water to 30 µL ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 μl USER Enzyme (NEB) was then incubated with size-selected ...
-
bioRxiv - Molecular Biology 2023Quote: ... Index Primers Set 3 (NEB). Amplified libraries were cleaned up using Sample Purification Beads (NEB ...
-
bioRxiv - Genomics 2020Quote: ... A-tailing 3’ end was performed using Klenow Fragment (3’→5’ exo-) (New England Biolabs), and then TruSeq Adapters were ligated by Quick T4 DNA Ligase (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by addition of 3’-A overhangs using Klenow Fragment 3’-5’ exo- (NEB, M0212S). After denaturation of DNA at 95°C for 3 min ...
-
bioRxiv - Cell Biology 2021Quote: ... A-tailing 3’ end was performed using Klenow Fragment (3’→5’ exo-) (New England Biolabs), and then TruSeq Adapters were ligated by Quick T4 DNA Ligase (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2022Quote: ... using the random primer method (Random Primer 6, NEB S1230S ...