Labshake search
Citations for New England Biolabs :
51 - 100 of 4333 citations for 2H Pyrazolo 4 3 c pyridine 3 chloro 4 5 6 7 tetrahydro since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... 6 and 4 μL of 6× Gel Loading Dye (B7025S, New England Biolabs) and 1.5 and 1 μL of 2.5 mg/mL EtBr were added ...
-
bioRxiv - Cell Biology 2020Quote: ... Renilla luciferase was PCR amplified from pMT-DEST48-FLP 31 with Renilla Luciferase Forward: 5’-TGGAAGCTTGGCATTCCGGTACTGTTGGTAAAGCCACCATGACTTCGAAAGTTTATG-3’ and Renilla Luciferase Reverse: 5’-TGGAAGCTTTTATTATTGTTCATTTTTGAGAAC-3’ and digested with HindIII (NEB). Renilla luciferase was then ligated into pGL3-Control digested HindIII (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ adapter (RNA oligo: 5’P-GAUCGUCGGACUGUAGAACUCUGAAC-3’InvdT) was pre-adenylated prior to use (5’ DNA adenylation kit, NEB, according to the manufacturer’s instructions) ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA fragments were end-repaired and T-tailed with Klenow fragment lacking 5’ → 3’ and 3’ → 5’ exonuclease activity (NEB). In-house adapters containing 8-nucleotide unique molecular identifier (UMI ...
-
bioRxiv - Systems Biology 2021Quote: ... 1 µL of the boiled colony was used for PCR with primer pair (JGI_27F: 5’-AGAGTTTGATCCTGGCTCAG-3’and JGI_1391R: 5’-GACGGGCRGTGWGTRCA-3’) with NEB Q5 Polymerase (New England Biolabs, Ipswitch, MA). The PCR amplicon was confirmed by agarose gel electrophoresis and the sequence was determined using conventional Sanger Sequencing (Genewiz LLC ...
-
bioRxiv - Genetics 2022Quote: ... was assessed via PCR amplification using OneTaq 2x Master Mix (forward primer DLO1142 5’-ACCCATTTCCCATTCAATCA-3’ reverse primer DLO1143 5’-TTGTAATCTGCCCCAAAAGG-3’) and subsequent HpaII restriction digest (New England Biolabs). DLW135 carried a wild type allele of pho-9 ...
-
bioRxiv - Neuroscience 2020Quote: ... FP: 5’-AGCAAGGCTAGCCAAGACAAGTTTGTAC-3’ and RP: 5’-ACTCACGGGCCCTAGTGGGCAGATCTT-3’ and cloned between Nhe-1 and Apa1 (NEB, Ipswich, MA, USA) sites in mec4p::Lamp-1::GFP.
-
bioRxiv - Microbiology 2021Quote: 16S rRNA gene regions V3-V4 were amplified with primers 314F (5’-CCTAYGGGRBGCASCAG-’3) and 806R (5’-GGACTACNNGGGTATCTAAT-3’) with Phusion High-Fidelity PCR Master mix (New England Biolabs) and amplified products were verified using Agilent 5400 Fragment analyser ...
-
bioRxiv - Cell Biology 2022Quote: ... It was followed by a second In-Fusion HD cloning of a polymerase chain reaction using 5’-GAAGGGGATCCACCGATGGTGAGCAAGGGCGAGG-3’ / 5’-TTAGTAGCTCTAGACTTGTACAGCTCGTCCATGCC-3’ (mScarlet insert) using BamHI and XbaI (New England Biolabs).
-
bioRxiv - Molecular Biology 2024Quote: ... The CHD4-GFP mutant was cloned with selective primers (fwd, 5’-GGATGCTACAGGTGGAACCCTGCACCCCTA-3’; rev, 5’-GCCCAGGCCCGACGCCAT-3’) and a Q5 site-directed mutagenesis kit (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNA resistant mCherry-ALG-2 was created by mutagenesis (primers sequences 5’-ATTTCGATGTTTGACCGTGAGAAC-3’, 5’-AATGGACCTGACAGTCACTGGATTAAA-3’) using a Q5 Site-Directed Mutagenesis Kit (E0554S, NEB). The plasmid encoding IST1-GFP is as described (63 ...
-
bioRxiv - Bioengineering 2023Quote: ... The β2-tubulin locus was amplified with the 1114A.S43 (5’ GAGAGCAACACTCGTGCG 3’) and 1114A.S44 (5’CAGGGTGGCATTGTACG 3’) primers and the amplicon was digested with Fspl (NEB cat#R0135S) or Ddel (NEB cat#R0175S ...
-
Neural mechanisms underlying uninstructed orofacial movements during reward-based learning behaviorsbioRxiv - Neuroscience 2023Quote: ... and a pair of oligonucleotides (Forward, 5’-CACCGTCAATAATGAGGTGGTCCGA-3’; Reverse, 5’-AAACTCGGACCACCTCATTATTGAC-3’) was ligated with T4 DNA Ligase (M0202, New England BioLabs).
-
bioRxiv - Bioengineering 2023Quote: The barcoded FXN region was recovered from the resulting cDNA library or DNA using primers of 5’-TGGACCTAAGCGTTATGACTGGAC-3’ and 5’-GGAGCAACATAGTTAAGAATACCAGTCAATC-3’ and PCR was performed using Q5 2x Master Mix (New England BioLabs) at 25 cycles of 98°C for 10s ...
-
bioRxiv - Cancer Biology 2023Quote: ... Half-hairpin sequences were amplified from the genomic DNA (common forward primers 5′- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTCTTGTGGAAAGGACGA-3′ and reverse primer 5′-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCTACTATTCTTTCCCCTGCACTGT-3′) using Q5 High-Fidelity 2x Master Mix (NEB). PCR reactions were cleaned up using Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Developmental Biology 2023Quote: The myo1g ORF was amplified from mixed stage pool of cDNAs using primers 5’-GATCCCATCGATTCGATGGCGGAGCTGGAGGGCTTG-3’ and 5’-AGGCTCGAGAGGCCTTACTGGGGCAGGAGTAAGG-3’ and cloned into the pCS2+ vector using Gibson assembly mix (NEB). Bold letters in the primer sequences indicate Gibson overhangs that are also present in the pCS2+ sequence ...
-
bioRxiv - Cell Biology 2024Quote: ... The mutagenesis primers for the addition of the STOP codon at the end of the MPV17 gene from MPV17-HA plasmid (F: 5’-TAATCTAGAATGTACCCATACGATGTTC-3’; R: 5’-GAGCCGATGTGCCTTCCA-3’) were generated using the NEBaseChanger bioinformatic tool (NEB). The mutation was confirmed and the plasmids were validated using Sanger sequencing (Eurofins Discovery).
-
bioRxiv - Neuroscience 2024Quote: ... The UNC13A CE was amplified with a forward primer in exon 19 5’-CAGACGATCATTGAGGTGCG-3’and reverse primer in exon 22 5’-ATACTTGGAGGAGAGGCAGG-3’using Q5 High Fidelity Master Mix (NEB). PCR products were resolved on a TapeStation 4200 (Agilent ...
-
bioRxiv - Developmental Biology 2024Quote: ... pax9el622 fish were genotyped using primers F3 (5’-TCGGAACAGGTCAGAATAGGA-3’) and R3 (5’-TCGGAACAGGTCAGAATAGGA-3’) and Bsrl digestion (New England Biolabs), producing digested wild-type bands (611 and 186 bp ...
-
bioRxiv - Cell Biology 2024Quote: ... FP: 5’-AGCAAGGCTAGCCAAGACAAGTTTGTAC-3’ and RP: 5’-ACTCACGGGCCCTAGTGGGCAGATCTT-3’ and cloned between Nhe-1 and Apa1 (NEB, Ipswich, MA, USA) sites in TTpl503 [mec4p::Lamp-1::GFP]
-
bioRxiv - Genomics 2021Quote: ... using Large Klenow fragment 3’-5’ exo- (NEB).
-
Autorepression of Yeast Hsp70 co-chaperones by intramolecular interactions involving their J-domainsbioRxiv - Biochemistry 2024Quote: ... SIS1VR 5’- CCAATCTGTTCGCGGTGAGCCTCA-3’) by Gibson Assembly (NEB). All constructs were confirmed by sequencing.
-
bioRxiv - Molecular Biology 2023Quote: ... by using Klenow Fragment (3′→5′ exo-) (NEB) for 30 min at 37 °C and purified by QIAquick PCR Purification Kit ...
-
bioRxiv - Plant Biology 2024Quote: ... A-tailed with Klenow 3’-5’ exo-(NEB), and truncated Illumina adapters were added with T4 DNA ligase (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µ l of Klenow Fragment (3’→5’ exo-, NEB, M0212S) 3µl of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3’ end filling and dA tailing was performed by Klenow Fragment (3’>5’ exonuclease deficient; NEB). Libraries were prepared by ligation of NEBNext adapters and indexed i7 primers (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ...
-
bioRxiv - Genetics 2021Quote: ... pUASTattB-3xHA::amxFL described above was used as a template to amplify and add appropriate homology arms to the SS-3xHA::Amx DNA sequence with the primers 5’- CCCCGCTCTATCTGACCAAAGCCACCATGAGGCTCCAACGAC-3’ and 5’- AAAACTAAACTAAGAACGGACTACTATATGTAAAGTGAGCCATCCGC-3’ using Q5® High-Fidelity 2X Master Mix (M0492S, NEB). The section of pattB-amx plasmid containing the amx regulatory elements was linearized by PCR using Q5 polymerase and primers 5’- CGTTGGAGCCTCATGGTGGCTTTGGTCAGATAGAGCG-3’ and 5’- GCTCACTTTACATATAGTAGTCCGTTCTTAGTTTAGTTTTACAGGGGT-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... Subclones were screen for correct targeting by PCR amplification and restriction enzyme digestion (Forward: 5’-GTAGTACCATGCCGAAAGCAC-3’, Reverse: 5’-GGAACCACCTATCTGTTATCC-3’, Restriction Enzyme: TseI, NEB R0591). Knockout lines were identified by Sanger sequencing (Sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... Subclones were screen for correct targeting by PCR amplification and restriction enzyme digestion (Forward: 5’-TGGCGCTAGTATTTGAAGCA-3’, Reverse: 5’-ACTTGGGATCCAATTCTGTCTACT-3’, Restriction Enzyme: EcoRI, NEB R3101). Specific mutations were identified by Sanger sequencing (Sequencing ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl of 10 mM dATP and 3 μl of 5 U/μl of Klenow fragment (3′→ 5′ exo (-)) (NEB, M0212) were added and the sample was incubated for 30 min at 37 °C followed by a deactivation step at 65 °C for 20 min ...
-
bioRxiv - Genetics 2020Quote: ... 5’-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCACTGT-3’ (8bp Barcode) and P5 overhang: 5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTTGTGGAAAGGACGAAACACCG-3’ using Q5 Hot Start High-Fidelity polymerase (NEB, #M0494S) for 21-24 cycles ...
-
bioRxiv - Microbiology 2021Quote: ... E1E2 sequence was amplified via PCR from pcDNA E1E2 vector using primers (forward 5’ CGAAGCTTGCATGGGTTGCTCTTTC 3’. and reverse 5’ CAGAATTCCCGCCTCCGC 3’) the product was subsequently digested with HindIII and EcoRI (NEB, USA) and ligated into pEGFP-N1 to create a E1E2-EGFP fusion construct with EGFP at the C-terminal end.
-
bioRxiv - Microbiology 2022Quote: Libraries cloned in the pYD1 vector were amplified using forward 5’-TTAAGCTTCTGCAGGCTAGTGGTG-3’ and reverse 5’-CACTGTTGTTATCAGATCAGCGGG-3’ primers with Taq DNA Polymerase and ThermoPol Buffer (New England Biolabs Ltd) for 16 cycles of 95°C for 30 sec ...
-
bioRxiv - Genetics 2022Quote: ... locus using the primers ubb polyA fw: 5’-TAGAACCGACAGTCTTAGGGATGG-3’ and ubb polyA rv: 5’-GAATTCATTGCCATCAAGTGTTAGC-3’ with Phusion High Fidelity DNA Polymerase (NEB M0530S), subcloned into the Zero Blunt TOPO PCR Cloning vector (Invitrogen K283020) ...
-
bioRxiv - Genomics 2023Quote: ... using 0.3 μM of dual-indices primers (forward: 5’:AATGATACGGCGACCACCGAGATCTACACCTCCAAGTTCACACTC TTTCCCTACACGACGCTCTTCCGATCT-3’; reverse 5’-CAAGCAGAAGACGGCATACGAG ATCGAAGTATACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTAGCAAACTGGGG CACAAGC-3’) and amplified using Q5 2X master mix (NEB #M0541S) according to the following protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 3-6 hours in 20 μl 1x CutSmart buffer (NEB), 0.2 μl was quantified using PicoGreen DNA (Life Technologies) ...
-
bioRxiv - Microbiology 2021Quote: ... 4°C and the supernatant applied on a 6 ml gravity flow column with Chitin resin (New England Biolabs), equilibrated with 20 mM HEPES ...
-
bioRxiv - Genomics 2021Quote: The beads were magnetically separated and resuspended in 20 µl of 3’ end RNA dephosphorylation mixture (4 µl 5x PNK pH 6.5 buffer, 0.5 µl PNK [New England Biolabs; with 3’ phosphatase activity] ...
-
bioRxiv - Pathology 2020Quote: ... at 65⁰C for 2h followed by MspI (NEB R0106) at 37⁰C overnight ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was PCR amplified using primers: 5’-gaagaaatgaatttgccagg-3’ and 5’-ctcatgttcttcttgggc-3’ and Phusion DNA Polymerase Master mix (New England Biolabs, Ipswich, MA). DNA was sent for Sanger Sequencing to check for reversion mutations.
-
bioRxiv - Plant Biology 2022Quote: The pVecBar-Rht13 construct contained a 6,998 bp fragment including 2,532 bp upstream and 450 bp downstream regions amplified from Magnif mutant genomic DNA using primers Rht13-NotF2 (5’ AATGCGGCCGCAATCGATAGGAGAGCTGCGTCTGTGTG 3’) and Rht13-AscR2 (5’ TGCGTACGGCGCGCCGAGAGTCGCCTTGCCAGTTC 3’) with Phusion® High-Fidelity DNA Polymerase (NEB, USA). pVecBarIII is a derivative of pWBvec8 (Wang et al. ...
-
bioRxiv - Genetics 2023Quote: The yeast plasmids recovered after thermoselection were subject to a shortened PCR with 15 cycles with oligonucleotide pairs oWS1408 (5°-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCAGCATATAATCCCTGCTTTA-3°) and oWS1409 (5°-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCCAGGGGTGGTGCAAACTATG-3°) using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA) to attach overhang sequences ...
-
bioRxiv - Biochemistry 2023Quote: ... and “frq segment 4F” (5’-CACCGATCTTTCAGGAGACCCTG-3’) and “frq segment 4R” (5’-CACTCAGGTC TCAATGGTGA TG-3’) pair with pCB05 digested with FseI (NEB, Catalog # R0588S) and MluI (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... “frq segment 3F” (5’-GTCGCACTGGTAACAACACCTC-3’) and “frq segment 3R” (5’-CAGCACATGTTCAACTTCATCAC-3’) were designed for pCB05 digested with NruI (NEB, Catalog # R0192S) and FseI (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... The variable region V3+V4 of the 16S rRNA gene was amplified using a broad-range primer pair (338F: 5’-ACTCCTACGGGAGGCAGCA-3′, 806R:5′-GGACTACHVGGGTWTCTAAT-3′) using the Phusionâ High-Fidelity PCR Master Mix (New England Biolabs, Beverley, MA). The PCR amplification program was as follows ...
-
bioRxiv - Molecular Biology 2024Quote: ... The library was amplified in triplicate PCR reactions using oligonucleotides corresponding to the Illumina sequence adaptors (5’-AATGATACGGCGACCACCGAGATCTACAC-3’ and 5’-CAAGCAGAAGACGGCATACGAGAT-3’) and Phusion DNA polymerase (New England Biolabs, cat. M0531) for 11 cycles ...
-
bioRxiv - Biophysics 2024Quote: ... The PDZ and Protease domain of HtrA1 were amplified using primers 5’-ATCACCAAGAAGAAGTATATTG-3’ and 5’-GGATCCTTTTTCGAACTGC-3’ as well as 5’-TAGCTCGAGCACCACCAC-3’ and 5’-TTTGGCCTGTCGGTCATG-3’with a NEB Q5® Site-Directed Mutagenesis Kit (New England Biolabs, MA). The mutation of S328A of HtrA1 and its Protease domain were created using primers 5’-CTATGGAAACgcgGGAGGCCCGT-3’ and 5’-TTGATGATGGCGTCGGTCTG-3’ with a NEB Q5® Site-Directed Mutagenesis Kit (New England Biolabs ...
-
bioRxiv - Biophysics 2024Quote: ... The mutation of S328A of HtrA1 and its Protease domain were created using primers 5’-CTATGGAAACgcgGGAGGCCCGT-3’ and 5’-TTGATGATGGCGTCGGTCTG-3’ with a NEB Q5® Site-Directed Mutagenesis Kit (New England Biolabs, MA). The PCR protocol was as followed ...
-
bioRxiv - Cancer Biology 2023Quote: ... Nuclei were centrifuged (500xg, 5 min, 4°C) and washed once with 1X NEBuffer 2.1 (NEB, #B7202). For nucleosome depletion ...