Labshake search
Citations for New England Biolabs :
9601 - 9650 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: m6A seq was performed on 2×107 cells using EpiMark N6-methyladenosine enrichment kit (New England Biolabs). The libraries were prepared from purified DNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA library preparation was done using the NEBnext Ultra II DNA Library Prep Kit (New England Biolabs) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA library preparation was done using the NEBnext Ultra II DNA Library Prep Kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... end-repair and A-Tailing were directly performed using the NEBNext UltraII DNA kit (New England Biolabs). A new custom universal Y-adapter based on the Illumina TruSeq sequences was designed to include a Unique Molecular Index (UMI ...
-
bioRxiv - Cancer Biology 2024Quote: Total cellular RNA was isolated using the Monarch Total RNA Miniprep Kit (#T2010, NEB, Ipswich, MA, USA) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was extracted from differentiated hiPSC-CMs using the Monarch Total RNA Miniprep Kit (NEB #T2010) and equal amounts of RNA per sample were transcribed into cDNA using the GoScriptTM Reverse Transcription Kit (Promega #A5000) ...
-
bioRxiv - Biochemistry 2024Quote: ... The transcription process was driven by T7 polymerase using HiScribe T7 High Yield RNA Synthesis Kit (NEB). After 2h transcription ...
-
bioRxiv - Microbiology 2024Quote: ... Second strand synthesis of the cDNA was carried out using the NEBNext second strand synthesis kit (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA isolated from cells was reverse transcribed using LunaScript® RT SuperMix Kit (New England Biolabs) to generate cDNA as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were prepared using the NEBNext Ultra II DNA library prep kit for Illumina (New England Biolabs), profiled using the Agilent TapeStation D1000 high sensitivity ScreenTape on the Agilent 4150 TapeStation System ...
-
bioRxiv - Microbiology 2024Quote: ... inserted in plasmid vector pUC19 with the Gibson Assembly Master Mix kit (New England BioLabs, NEB # E2611S). Mutagenesis was carried out with the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... inserted in plasmid vector pUC19 with the Gibson Assembly Master Mix kit (New England BioLabs, NEB # E2611S). Mutagenesis was carried out with the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA was extracted from overnight cultures using the Monarch Genomic DNA Purification Kit (New England Biolabs) and quantified using the Qubit Broad Range dsDNA kit (ThermoFisher) ...
-
bioRxiv - Microbiology 2024Quote: The in vitro transcription assay was conducted using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Sequencing libraries were generated using NEB Next® UltraTM DNA Library Prep Kit for Illumina (NEB, USA) following the manufacturer’s recommendations and index codes were added ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was extracted from the agarose gel fragments using a gel extraction kit (New England Biolabs, T1020L) following manufacturer instructions with modification ...
-
bioRxiv - Microbiology 2024Quote: ... Mutagenesis of RBK21 constructs was carried out using the Q5 Site Directed Mutagenesis kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: RNA was extracted from samples using the Monarch® Total RNA Miniprep Kit (New England Biolabs, T2010S) and cDNA was synthesized using the ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs ...
-
bioRxiv - Neuroscience 2024Quote: ... and cDNA was synthesized using the ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs, E6560L). Target sequences were amplified using a modified touchdown PCR protocol (Korbie and Mattick ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library quantification was done using NEB Next® Library Quant Kit for Illumina® (New England Biolabs) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... and TOP2B D64N self-trapping mutants were generated by the Q5 SDM Kit (NEB, catalog no. E0554S) following manufacturer’s instruction and mutation confirmation by sequencing ...
-
bioRxiv - Evolutionary Biology 2024Quote: Libraries were prepared using the NEBNext Ultra II DNA library Kit (New England Biolabs GmbH, Frankfurt, Germany) with purification beads and 100 ng of the fragmented/non-fragmented DNA in a volume of 25 µl were used as input according to the manufacturer’s protocol with some alterations ...
-
bioRxiv - Genomics 2024Quote: ... Ribosomal RNA was depleted from total input RNA using the NEBNext rRNA Depletion Kit (NEB cat. #E6310). First and second strand synthesis ...
-
bioRxiv - Genetics 2024Quote: ... and deletion mutant zebrafish larvae using the Monarch Total RNA Miniprep Kit (New England Biolabs (NEB, T2010S) and reverse-transcribed with High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Genetics 2024Quote: ... CUT&RUN libraries were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB; E7645L) and sequenced on NextSeq500 (paired-end ...
-
bioRxiv - Genetics 2024Quote: ... and deletion mutant zebrafish larvae using the Monarch Total RNA Miniprep Kit (New England Biolabs (NEB, T2010S) and reverse-transcribed with High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Systems Biology 2024Quote: TT-seq libraries were built using the NEBNext Ultra II RNA Library prep kit for Illumina (NEB) according to the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2024Quote: Final libraries were prepared on beads using the NEBNext Ultra II DNA Library Prep Kit (NEB, #E7645) as follows ...
-
bioRxiv - Genomics 2024Quote: ... 200ng of each sample was enzymatically converted using the NEBNext® Enzymatic Methyl-seq Kit (NEB, E7120) with the manufacturer’s protocol ...
-
bioRxiv - Genomics 2024Quote: ... Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Immunology 2024Quote: ... Complementary deoxyribonucleic acid (cDNA) was synthesized using the ProtoScript First-Strand cDNA Synthesis kit (New England Biolabs). Real-time PCR assays were performed using a CFX Connect Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Cell Biology 2024Quote: ... and the vector was extracted from the gel using a Monarch DNA Gel Extraction Kit (NEB #T1020). Gibson Assembly of the three generated fragments was performed using NEBuilder HiFi DNA Assembly Master Mix (NEB #E2621) ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA was synthesized from 300 ng of purified RNA using LunaScript RT SuperMix kit (New England BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2024Quote: ... Strand-specific libraries were prepared by the NEBNext Ultra II Directional RNA Library Preparation kit (NEB, USA), as described previously (Makhnovskii et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... RNAseq libraries were constructed using a NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs). mRNA pull-down was performed using the Magnetic Isolation Module (New England Biolabs) ...
-
bioRxiv - Microbiology 2024Quote: ... coli isolates was purified using a Monarch DNA purification kit (New England Biolabs Japan Inc., Tokyo, Japan). DNA concentrations were measured using Qubit™ 4 fluorometer with Qubit™ 1× dsDNA High Sensitivity (HS ...
-
bioRxiv - Molecular Biology 2024Quote: ... POINT-seq libraries were made with the NEBNext® UltraTM II Directional RNA Library Prep Kit (NEB). POINT5-seq libraries were made with the SMARTer Stranded RNA-Seq kit (Takara Bio ...
-
bioRxiv - Molecular Biology 2024Quote: ... and in vitro transcribed RNA was purified using the using the Monarch® RNA Cleanup Kit (NEB). Full-length 5’ RACE was performed using the GeneRacer™ with Superscript™ III RT kit (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... it was performed following the instructions of Luna Universal qPCR Master Mix Kit M3003E (New England BioLabs, USA). Samples of eyelids ...
-
bioRxiv - Biochemistry 2020Quote: ... Sequencing libraries were generated using a NEBNext®UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Immunoprecipitated chromatin was used for NGS library preparation (NEBNext Ultra II DNA Library Prep Kit for Illumina, NEB). Libraries were sequenced at the Max Planck Institute of Immunology and Epigenetics using HiSeq 3000 (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA of all cell lines was isolated using Monarch Total RNA miniprep kits (#T2010S, New England Biolabs) according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... NGS libraries were prepared using the NEBnext Ultra II DNA library preparation kit for Illumina (New England Biolabs) according to manufacturer’s recommendations ...
-
bioRxiv - Systems Biology 2020Quote: Poly-A RNA sequencing libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit (NEB) according to the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2020Quote: ... The ClbI C-terminal GFP fusion was constructed using the Gibson Assembly kit (New England Biolabs, MA, USA). Briefly ...
-
bioRxiv - Systems Biology 2020Quote: ... Prokaryotic DNA was enriched from the total hindgut DNA extract using NEBNext Microbiome DNA Enrichment Kit (NewEngland BioLabs). Following sequencing ...
-
bioRxiv - Cancer Biology 2021Quote: ... sgRNA (XXXXXXXX for KPC1 or CGGCGGCGGGATGTTCGTGC for KPC2) were synthetized in vitro using EnGen sgRNA Synthesis kit (NEB) and purified using RNA clean and concentrator (Zymo Research) ...
-
bioRxiv - Developmental Biology 2021Quote: ... The sequencing libraries were constructed with NEB NextR UltraTM DNA Library Prep Kit for Illumina (NEB, United States) following the manufacturer’s instructions and index codes were added ...
-
bioRxiv - Cell Biology 2020Quote: ... The FER1 Ca2+-binding mutants in the C2D domain were generated by Q5 site directed mutagenesis kit (NEB) using primers 4833/4834 to change positions A1622 and A1634 to C resulting in Asp codon 542 and 545 changes to Ala.
-
bioRxiv - Cell Biology 2020Quote: ... Single or double mutations were produced with the Q5® Site-directed Mutagenesis kit (New England Biolabs, UK) using the primers in Table 1.