Labshake search
Citations for New England Biolabs :
9451 - 9500 of 10000+ citations for Glutathione Fluorescent Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 3 µl of extracted RNA was used in a TaqMan one-step qRT/PCR assay (Luna® Universal One-Step RT-qPCR Kit, NEB). TaqMan analysis was carried out with primer/probe combination described in Table 1 and analysis performed on the QuantStudio™ 6 Flex System (ThermoFisher Scientific).
-
bioRxiv - Microbiology 2020Quote: ... was in-vitro transcribed from 1 μg of these templates using the HiScribe T7 High Yield RNA synthesis kit (NEB, E2040S). Reactions were incubated at 37°C for 4 hours and run on a 6% TBE-Urea gel (Invitrogen ...
-
bioRxiv - Cell Biology 2019Quote: ... and YQDA (D434W Y415A A463W Q433W) fused to a mCherry N-terminal tag were cloned using the NEBuilder HiFi DNA Assembly Cloning Kit (NEB #E5520) and introduced into pBlueScriptII with a VHA-6 promoter and tub terminator using the primers pvha6_fwd gacggtatcgataagcttgatatcggtatactatttattactcgatacttttg ...
-
bioRxiv - Cell Biology 2019Quote: ... and UBA domain (L309D, M332K/Y334F, and ΔYFLLL) mutants were generated using Q5 Hot Start Site Direct Mutagenesis kit (New England BioLabs, E0552S). BRSK2 domain deletion mutations ΔN (Δ kinase) ...
-
bioRxiv - Cell Biology 2020Quote: ... the pT7-SVmCherry plasmid was first linearised with XhoI and used as a template for in vitro RNA transcription with HiScribe T7 ARCA mRNA kit (New England Biolabs, #E2065S). Transcribed genomic RNA was transfected into BHK-21 using Lipofectamine 2000 reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... Expression of mRNA transcripts for PfRFC1 gene analysis were carried out using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs, Inc.), on a QuantStudio 5 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2020Quote: ... libraries were prepared using the NEB Ultra II Library Preparation Kit and NEBNext® Multiplex Oligos for Illumina (Dual Index Primers Set 1) (New England BioLabs). The generation of the libraries followed manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: E248R deletion mutant proteins of distinct domains (Δ constructs) were generated from E248R WT plasmid by site direct mutagenesis using the Q5 mutagenesis kit (New England Biolabs) as follows ...
-
bioRxiv - Cell Biology 2020Quote: ... The presence of the PCR products was confirmed by gel electrophoresis and the products were then purified by Monarch® PCR & DNA Cleanup Kit (New England Biolabs).
-
bioRxiv - Genetics 2021Quote: For CUT&RUN-sequencing libraries were made starting from 10 ng of CUT&RUN DNA fragments using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB #E7645S) using the following PCR program ...
-
bioRxiv - Genetics 2021Quote: ... DNase libraries were prepared for sequencing using NEBNext Ultra II DNA Library Prep Kit for Illumina following the manufacturer’s instructions (NEB, cat. # E7645), with double-sided SPRI size selection (Agencourt AMPure XP beads ...
-
bioRxiv - Genetics 2021Quote: ... and a 50-μl aliquot containing between 832-841 ng was provide to the KU Genome Sequencing Core for library construction using the NEBNext Ultra II DNA Library Prep Kit (NEB, E7645L), incorporating unique dual-indexing (NEB ...
-
bioRxiv - Genetics 2021Quote: ... We converted oligo(dT)-selected RNA into a cDNA library for mRNA sequencing using the NEBNext Ultra™ Directional RNA Library Prep Kit for Illumina (NEB) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... 50 ng of m6A-containing mRNAs or pre-immunoprecipitated mRNAs (the input) were used for library construction by the NEBNext ultra RNA library preparation kit (NEB, E7530). High-throughput sequencing was conducted on the illumina HiSeq X sequencer with a paired-end read length of 150 bp following the standard protocols ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sequencing libraries were made using the NEB Next Ultra II DNA library kit (New England BioLabs Inc, Ipswich, MA, Cat #E7645S) and were sequenced on the Illumina Hi-Seq4000 using 50bp single-end reads at the Northwestern Sequencing Core (NUCore).
-
bioRxiv - Microbiology 2021Quote: ... A plasmid encoding an eGFP-containing EBOV antigenome was generated through assembly of fragments using the NEBuilder HiFi DNA assembly cloning kit (New England Biolabs (NEB)) ...
-
bioRxiv - Microbiology 2019Quote: ... Sequencing libraries were generated using the resulting ribosomal transcript-depleted RNA and NEBNext Ultra II Directional RNA Library Prep Kit (NEB, USA) according to the manufacturers’ protocol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... with NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolab E7420L) and NEBnext Multiplex Oligos for Illumina Dual Index Primers (New England Biolabs E7600S), using provided protocols and 500 ng of total RNA ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... corresponding to a partial ASY3 DEL allele was excised and purified with a Monarch® DNA Gel Extraction kit (New England Biolabs). Purified PCR products were cloned into pCR™4-TOPO® vector using a TOPO™ TA Cloning™ for Sequencing Kit (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were prepared with 50 ng of DNA using the NEBNext Ultra II DNA Library Prep kit for Illumina (New England Biolabs®) as per the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2021Quote: ... DNA libraries for RNAseq analysis were prepared using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, NEB) and NEBNext rRNA Depletion Kit (Human/Mouse/Rat ...
-
bioRxiv - Developmental Biology 2020Quote: ... A 250-300 bp insert cDNA library was generated by using the NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, E7530S). Transcriptome sequencing was performed on an Illumina NovaSeq 6000 ...
-
bioRxiv - Immunology 2021Quote: ... Illumina adaptors were ligated using NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (New England BioLabs, USA) according to the manufacturer’s protocol and sequencing in the Illumina platform with the PE150 mode ...
-
bioRxiv - Developmental Biology 2021Quote: ... Library preparation (from precipitated material and input chromatin as control) was performed using NEBNext Ultra II DNA library Prep Kit (New England Biolabs, #E7645S) without size-selection to maintain sample complexity and according to manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... The purified rRNA-depleted samples were converted to cDNA as per the NEBNext ultra II RNA library prep kit for Illumina (NEB, E7770L). Total RNA from the rest of the samples was converted to cDNA according to the ARTIC amplicon sequencing protocol for SARS-CoV-2.artic ARTIC protocol primer artic schemes for SARS-CoV-2 (Version 2 ...
-
bioRxiv - Microbiology 2022Quote: ... RNA-seq libraries were generated using the NEBNext Ultra Directional RNA Library Prep kit for Illumina with NEBNext® Poly(A) mRNA Magnetic Isolation Module (both New England BioLabs). Samples were adjusted to 400 ng total RNA and spiked with diluted 1/100 ERCC Spike-In Mix (4456740 ...
-
bioRxiv - Neuroscience 2022Quote: ... Total RNA preparations were then used directly for qPCR (200 ng total RNA per reaction) using the Luna Universal One-Step RT-qPCR Kit (NEB, E3006) and target-specific primer/probe sets (ThermoFisher ...
-
bioRxiv - Neuroscience 2021Quote: ... total RNA (1 µg) was transcribed into cDNA using ProtoScript® II First Strand cDNA Synthesis Kit (Cat. No. E6560; New England BioLabs). Quantitative real-time PCR was performed with 20 ng of cDNA in a total reaction volume of 10 μL using Luna® Universal qPCR Master Mix (Cat ...
-
bioRxiv - Neuroscience 2021Quote: ... was used to generate RNA-seq libraries using the NEBNext Ultra Directional RNA library Prep Kit for Illumina (New England BioLabs, Inc) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Hippocampus RNA-seq libraries were prepared in accordance with New England Biolab protocols (NEBNext_ Ultra II RNA library Prep kit for Illumina, NEB, USA). Briefly ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA synthesis was performed from 1 µg total RNA using the ProtoScript® First Strand cDNA Synthesis Kit (New England Biolabs, NEB) with the provided random primer mix according to the suppliers’ instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... 100 ng of two replicates each of AbmR co-purified RNA and rRNA-depleted induced E.coli control RNA were converted into RNA-seq libraries using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, USA) per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: Total and nascent RNA libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, E7760S) following the rRNA depleted RNA protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... The amplicon was purified with a Qiagen PCR purification kit and digested with the restriction enzymes KpnI and HindIII (NEB, UK), followed by ligation using T4 DNA ligase (Fermentas ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the next two fragments were inserted into resulting plasmid using NEBuilder®HiFi DNA Assembly Cloning Kit (New England Biolabs). Fragments were amplified with primers (Table S1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... from COLO205 cells was subjected to one-step RT-qPCR analysis using the Luna Universal One-Step RT-qPCR Kit (NEB, E3005S) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... The sequencing library was prepared using the NEB Next Ultra II DNA Library Prep Kit for Illumina (New England Biolabs, E7645). Paired-end ...
-
bioRxiv - Genomics 2020Quote: ... ~200 ng of gDNA was used for library preparation with the NEBNext DNA Ultra II Library Prep Kit (New England Biolabs # E7645S) as per manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Purified dsDNA templates were used as templates for T7 transcription reactions using HiScribe™ T7 High Yield RNA Synthesis Kit (NEB) and bio-16-CTP (Trilink ...
-
bioRxiv - Genomics 2020Quote: A total of 1.5 μg of gDNA was end-repaired (NEBnext ultra II end repair kit, New England Biolabs, MA, USA) and purified using 1x AmPure beads (Beckmann Coulter ...
-
bioRxiv - Genomics 2020Quote: Plasmids containing H2afz-FKBP.knock-in.BFP and Nelfb-Halo DNA repair templates were synthesized with long homology arms (∼800 bp) by Genewiz FragmentGene and assembled using the NEBuilder HiFi DNA Assembly Cloning kit (NEB E5520S). The Dendra2-RBP1 plasmid and guide were used as previously described10.
-
bioRxiv - Genomics 2020Quote: ... An Illumina-compatible library was then prepared from 400 ng input gDNA with an NEBNext Ultra™ II FS DNA Library Prep Kit for Illumina (New England Biolabs) with a total of four PCR cycles to introduce dual indexed barcodes ...
-
BET protein inhibition regulates macrophage chromatin accessibility and microbiota-dependent colitisbioRxiv - Immunology 2021Quote: ... Transposed DNA samples were purified using the Qiagen MinElute Kit (#28204) followed by amplification using 1x PCR master mix (NEB #M0541S) and 25 μM Ad1_noMX and Ad2.* indexing primer for 10-14 cycles ...
-
bioRxiv - Molecular Biology 2021Quote: TCF20(1-1268)-mEGFP construct was generated from the TCF20-mEGFP plasmid using the Q5 Side-Directed Mutagenesis Kit (NEB, E0554S) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the libraries have been generated using NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (NEB, USA). The libraries have been purified using the AMPure XP system ...
-
bioRxiv - Molecular Biology 2021Quote: ... were used as template of the in vitro transcription (HiScribe™ T7 Quick High Yield RNA Synthesis Kit, #E2050S, New England Biolabs), performed at 37°C for 16 hr ...
-
bioRxiv - Synthetic Biology 2019Quote: ... plasmids from 120 CFUs with different phenotypes were isolated with the Monarch®Plasmid Miniprep Kit (New England Biolabs, Ipswich, USA) and analyzed via Sanger-sequencing (Eurofins Genomics ...
-
bioRxiv - Neuroscience 2019Quote: ... RNA-Seq libraries (400 bp) were created using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760L). Samples were individually indexed using the NEBNext Multiplex Oligos for Illumina (NEB #E6609S) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Further purification to remove contaminated genomic DNA was performed using a Monarch Total RNA Miniprep Kit (New England Biolabs, MA, USA), according to the supplier’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: Libraries for DNA sequencing were prepared according to the instructions accompanying the NEBNext DNA Ultra II kit (catalog # E7645S; New England Biolabs, Inc). Libraries were sequenced on the NextSeq 500 following the manufacturer’s protocols ...