Labshake search
Citations for New England Biolabs :
9451 - 9500 of 10000+ citations for 2 Arachidonoylglycerol 2 AG CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: ... Single point mutations in KIF1A were generated by the NEB Q5® site-directed mutagenesis kit (New England Biolabs Inc. #E0554S) and confirmed by sequencing.
-
bioRxiv - Cell Biology 2020Quote: ... A STOP codon was introduced at the end of the coding sequence of FLAG-UBE2K using the Q5 Site-Directed Mutagenesis Kit (E0554S, New England Biolabs GmbH) according to the manufacturer’s instructions and the primers TGATTGGACCCAGCTTTCTTG and GTTACTCAGAAGCAATTCTG.
-
bioRxiv - Cell Biology 2020Quote: ... Two missense point mutations present in the initial plasmid (c1411t and c2671t) were corrected using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, E0554S) according to manufacturer protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Antisense probes were converted to RNA from this template using the HiScribe™ SP6 RNA synthesis Kit (New England BioLabs, E2040S). Sense probes were converted to RNA from this template using the HiScribe™ T7 RNA synthesis Kit (New England BioLabs ...
-
bioRxiv - Cell Biology 2020Quote: ... Sense probes were converted to RNA from this template using the HiScribe™ T7 RNA synthesis Kit (New England BioLabs, E2070S). In each RNA synthesis reaction ...
-
bioRxiv - Cell Biology 2020Quote: ... Mutant constructs (fam83faF275A, fam83faF279A and fam83faF275/279A) were generated by site-directed mutagenesis using the Q5® Site-Directed Mutagenesis Kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... and 1 μg of purified PCR product was used as template for in vitro transcription using the HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs, E2040S) as described by the manufacturer.
-
bioRxiv - Genomics 2020Quote: ... Novogene prepared a PCR-free Illumina sequencing library using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs, USA), with the manufacturers protocol modified to give a 500 bp – 1 kb insert size ...
-
bioRxiv - Microbiology 2021Quote: ... The seven PCR products were assembled into the pCC1-F567-mNG plasmid that were pre-linearized with NheI and XhoI by using the NEBuilder® HiFi DNA Assembly kit (NEB) according to the manufacturer’s instruction ...
-
bioRxiv - Immunology 2020Quote: ... RNA sequencing libraries were prepared from 500 ng of each total-RNA sample using the NEBNEXT Ultra II Directional RNA Library Prep kit with Poly-A mRNA magnetic isolation (NEB #E7490) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2021Quote: ... or more amino acid substitutions in SecPH with Q5 PCR methodology (Q5®Site-Directed Mutagenesis Kit, New England Biolabs, E0554) or PCR site-directed mutagenesis strategy ...
-
bioRxiv - Molecular Biology 2021Quote: ... For the library preparation the NEBNext® Ultra™ II DNA Library Prep Kit from NEB (New England Biolabs, Ipswich, MA) was used ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids were assembled from fragments (linearized vector, PCR products, and/or synthetic DNA) using the NEBuilder Hifi DNA assembly kit (New England Biolabs (NEB) E2621) ...
-
bioRxiv - Microbiology 2020Quote: ... with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L, New England Biolabs Inc) and a reaction volume of 10 μl with 2.5 μl of sample ...
-
bioRxiv - Microbiology 2020Quote: ... with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L, New England Biolabs Inc) and a reaction volume of 10 μl with 2.5 μl of sample ...
-
bioRxiv - Immunology 2021Quote: ... were generated by introducing the corresponding amino acid mutations (Extended Data Fig. 5) using the Q5® Site-Directed Mutagenesis Kit (NEB) and per manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2020Quote: ... and quantified using qPCR with the NEBNext® Library Quant Kit for Illumina® (New England Biolabs® Inc., MA, USA). Following qPCR ...
-
bioRxiv - Microbiology 2021Quote: ... The OprCAA mutant was produced by changing the key amino acids Cys143 and Met147 to alanine residues using the KLD Quickchange site-directed mutagenesis kit (New England Biolabs, UK) and specific primers containing both mutation sites (forward ...
-
bioRxiv - Microbiology 2020Quote: ... Sequencing libraries were generated using NEBNext Ultra™ II DNA Library Prep Kit for Illumina (New England Biolabs; Ipswich, MA, USA), and the library quality was assessed on Qubit 3.0 Fluorometer (Life Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ChIP-seq libraries were prepared using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB E7645) according to manufacturer instructions with a few modifications ...
-
bioRxiv - Molecular Biology 2021Quote: ... and sequencing adaptors (5 μl) from the Ligation Sequencing Kit (ONT, #LSK109) and Quick T4 DNA Ligase (10 μl) (NEB, M2200S) were added to the cleaved and dA-tailed gDNA sample ...
-
bioRxiv - Molecular Biology 2021Quote: RT-LAMP reactions were performed using either WarmStart® Colorimetric LAMP 2X Master Mix (DNA & RNA) (M1800) or WarmStart® LAMP Kit (DNA & RNA) (E1700) from New England Biolabs (NEB). 40 mM guanidine hydrochloride was included in all reactions to improve LAMP reaction speed and sensitivity [10] ...
-
bioRxiv - Molecular Biology 2021Quote: Site-directed mutagenesis of the AP-1 binding sites in the distal enhancer reporter plasmids were performed using the Q5® Site-Directed Mutagenesis Kit (New England BioLabs). Primer pairs 5’-CCATAATGTGgggCTATACTAAATTTCATCTTC-3’ and 5’-CTAAATCCACTTAGAAAAAACAATC-3’ ...
-
Nucleo-cytoplasmic shuttling of splicing factor SRSF1 is required for development and cilia functionbioRxiv - Molecular Biology 2020Quote: ... The guide region was then amplified by PCR and paired guide RNAs synthesised by in vitro transcription (T7 Quick High Yield RNA Synthesis kit, NEB, #E2050S). Single stranded DNA oligonucleotides (WT oligo ...
-
bioRxiv - Microbiology 2021Quote: ... The ChIP libraries were prepared using NEBNext® UltraTM II DNA Library Prep Kit for Illumina (Catalog: E7645S, New England Biolabs). The samples were subjected to various enzymatic steps to repair the ends and tailing with dA-tail followed by an adapter ligation ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA-seq libraries were prepared from total RNA using polyA selection followed by the NEBNext Ultra II Directional RNA Library Prep Kit protocol (New England Biolabs, E7760S). Sequencing was performed on Illumina HiSeq 2500 instrument resulting in approximately 30 million of 50 bp reads per sample ...
-
bioRxiv - Immunology 2021Quote: ... captured mRNA was processed for Next Generation Sequencing (NGS) using the NEB Next Ultra II RNA Library Prep Kit for Illumina (New England Biolabs, UK). Quality was assessed on the Agilent 2100 Bioanalyser using the High Sensitivity DNA Kit (Agilent ...
-
bioRxiv - Microbiology 2021Quote: ... followed by adaptor ligation and enrichment with a low-cycle according to the instructions of NEBNext UltraTM RNA Library Prep Kit for Illumina (NEB, USA). The purified library products were evaluated using the Agilent 2200 TapeStation and Qubit2.0 (Life Technologies ...
-
bioRxiv - Immunology 2020Quote: ... according to the manufacturer’s instructions.29 RNA reverse transcription and first strand cDNA synthesis were carried out using chain-specific reverse primers30 with ProtoScript® II First Strand cDNA Synthesis Kit (NEB). The resulting cDNA was used as template for preparing the sequencing library using 5’ multiplex PCR as previously described.31 The PCR products corresponding to the library amplification were purified on BluePippin with size cutoff around 500 bp ...
-
bioRxiv - Cell Biology 2021Quote: ... 100 ng of total RNA was used to generate RNA-seq library using NEBNext Ultra RNA Library prep kit (NEB, E7530L) according to the vendor’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... Resultant DNA was gel extracted then 400 ng template used for in vitro transcription with the HiScribe RNA synthesis T7 kit (NEB, E2040) for 2 hours at 37 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... BRCT domain (aa 560-777), BUDR (R705A, D712A, Q715R) were deleted or mutated using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, E0554S). The GFP-BARD1 constructs were shuttled into a lentiviral destination vector containing a UBC promoter and a hygromycin resistance gene using the Gateway LR Clonase II Enzyme Mix (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... The digestion product was resolved on a 0.7% agarose gel and the plasmid backbone was purified using the Monarch gel purification kit (NEB, Cat# T1020S). The ‘T2A-GFP-WPRE’ sequence was inserted into the digested backbone using the Gibson Assembly kit (SGI ...
-
bioRxiv - Genetics 2019Quote: ... Poly(A)+ RNA was selected from 1 μg of total RNA using the NEBNext Ultra Kit (New England Biolabs, Ipswitch, MA). Libraries were prepared and sequenced by Genewiz (South Plainfield ...
-
bioRxiv - Genomics 2021Quote: ... and the fragmented DNA was subjected to library preparation with NEBNext® Ultra II DNA Library Prep Kit for Illumina (E7645S, New England Biolabs). Sequencing was carried out on Illumina NovaSeq 6000 with 150bp paired end mode.
-
bioRxiv - Genomics 2021Quote: ... We prepared a total of 30 libraries using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs Inc.). We selected an insert size of 300 bp by using a fragmentation time of 5-12 min ...
-
bioRxiv - Genetics 2020Quote: ... RNA-seq libraries were prepared according to the protocol for use with NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E6310) and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760) ...
-
bioRxiv - Genomics 2019Quote: To prepare the RNA sample for use in a smallRNA library preparation kit the sample was phosphorylated using 5 ul of 10X T4 PNK buffer and 1 ul of T4 PNK (NEB #M0201), 1 ul of SUPERASE-In ...
-
bioRxiv - Microbiology 2020Quote: ... The sequencing libraries were created using the NEBNext® Ultra™ II DNA Library Prep Kit (New England Biolabs, MA, USA). Coverage values are reported in Table 1 ...
-
bioRxiv - Immunology 2022Quote: ... The immunoprecipitated DNAs were subsequently processed to generate a DNA library using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, # E7645L) and NEBNext® Multiplex Oligos for Illumina (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... night RNAseq libraries were produced according to the manufacturer’s protocol (NEBNext UltraII Directional RNA Library Prep Kit, Illumina, NEB, MA, USA) using aroung 1 000 ng of total RNA ...
-
bioRxiv - Microbiology 2022Quote: ... The viral cDNAs were synthesized from extracted RNA using the Luna Script RT Super Mix Kit (New England BioLabs, Ipswich, MA), followed by DNA amplification by multiplex PCR in two separated primer pools using ARTIC-N5 primers (59 ...
-
bioRxiv - Immunology 2022Quote: ... Caspase-11 catalytic (C254A) and cleavage (D285A) mutants were generated by site-directed mutagenesis (Q5 SDM Kit, New England BioLabs; #E0554S) of the wild-type parent vector according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... The library for sequencing was prepared using 1 µg of RNA and the NEBNext Ultra kit (New England BioLabs, Ipswich, MA), according to the protocol for low-input samples ...
-
bioRxiv - Microbiology 2022Quote: ... 1-step RT-qPCR was performed on 2μL of RNA using the Luna® Universal One-Step RT-qPCR Kit (NEB Biosciences) and primers for β-tubulin (F ...
-
An apical protein, Pcr2, is required for persistent movement by the human parasite Toxoplasma gondiibioRxiv - Cell Biology 2022Quote: ... and inserted between the BglII and AflII sites of ptubA1-mEmeraldFP-TUBA1[69] using the NEBuilder HiFi Assembly kit (New England Biolabs, #E2621S).
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries were made with 6 ng of CUT&RUN DNA fragments using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB #E7645S). The manufacturer’s protocol was adjusted to account for shorter DNA fragments as described previously (33) ...
-
bioRxiv - Molecular Biology 2022Quote: ... for each co-expressed DF-APOBEC1 protein using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760L) with NEBNext Poly(A ...
-
bioRxiv - Biochemistry 2022Quote: ... and for OGA we introduce a D174>A mutation with a Q5 site-directed mutagenesis kit (New England Biolabs cat # E05545). These mutations produce stable mutant proteins that abolish the catalytic activity of the enzymes (38,39) ...
-
bioRxiv - Cancer Biology 2022Quote: In vitro transcription of LINC00313 or firefly luciferase (F-luc) mRNA was performed using the HiScribe™ T7 High Yield RNA Synthesis kit (New England Biolabs), according to the instructions by the manufacturer ...