Labshake search
Citations for New England Biolabs :
901 - 950 of 6949 citations for rno mir 206 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... and the primers are phosphorylated using polynucleotide kinase prior (NEB) to PCR such that each PCR product strand can be immediately ligated to itself ...
-
bioRxiv - Genomics 2023Quote: ... Excessive primers were digested by Thermolabile Exonuclease I (NEB, M0568) at 37 °C for 30 min ...
-
bioRxiv - Genomics 2024Quote: ... and NEBNext Multiplex Oligos for Illumina (Dual Index Primers, NEB) following standard protocols ...
-
bioRxiv - Plant Biology 2023Quote: ... and 2μl random primer mix (New England Biolabs, cat#S1330S) were mixed and incubated for 10 minutes at 23°C then put on ice for 1 minute ...
-
bioRxiv - Genomics 2019Quote: ... was added to the RT product with Phusion polymerase (NEB) under standard PCR conditions ...
-
bioRxiv - Microbiology 2021Quote: ... and 4 μl LunaScript RT SuperMix (5X) (New England Biolabs) was added to each sample ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA synthesis was performed using LunaScript RT SuperMix Kit (NEB). Polymerase chain reactions were carried out using TaqMan 2X Universal PCR Master Mix or SYBR Green PCR Master Mix (Thermo ...
-
bioRxiv - Immunology 2022Quote: ... RT-qPCR was performed with Luna Universal qPCR reagent (NEB). eMLV env was detected with 5’-AGGCTGTTCCAGAGATTGTG-3’ and 5’-TTCTGGACCACCACATGAC-3’ and 18S rRNA was detected with 5’-GTAACCCGTTGAACCCCATT-3’ and 5’-CCATCCAATCGGTAGTAGCG-3’ on Roche LightCycler 480 II (104,105).
-
bioRxiv - Molecular Biology 2020Quote: ... 1μl of Luna WarmStart RT Enzyme Mix (New England Biolabs) and 3.9 μl water ...
-
bioRxiv - Microbiology 2021Quote: ... The cDNAs were synthesized with 10U of AMV RT (NEB) for 20 min at 42°C ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA synthesis was performed using LunascriptTM RT Supermix Kit (NEB) as per manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was generated from RNA by LunaScript RT SuperMix (NEB). PCR reactions targeting the 3CLpro gene were performed using Q5® High-Fidelity DNA Polymerase (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... Luna Universal One-Step RT-qPCR kit (New England Biolabs) was used following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... were used for reverse transcription using ProtoSciprt II RT (NEB). Synthesized cDNA was diluted five times in water ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse transcription was performed using LunaScript RT SuperMix Kit (NEB). Oligonucleotides used for qRT-PCR are listed in Supp ...
-
bioRxiv - Bioengineering 2022Quote: ... cDNA was generated using LunaScript RT Master Mix Kit (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Luna® Universal One-Step RT-qPCR Kit from NEB was used for RT-qPCR reactions ...
-
bioRxiv - Microbiology 2023Quote: ... 2ug RNA was reverse-transcribed using Lunascript RT (NEB E3010L), following the manufacturers protocol ...
-
bioRxiv - Microbiology 2023Quote: ... A single RT-LAMP reaction consisted of enzymes (RTx (NEB), Bst 2.0 (NEB) ...
-
bioRxiv - Genetics 2023Quote: ... The Luna Universal Probe One-Step RT-qPCR kit (NEB) following the manufacturer’s protocol was used for the quantification of IBV derived RNA using IBV specific primers (forward 5′-GCTTTTGAGCCTAGCGTT-3′ and reverse 5′-GCCATGTTGTCACTGTCTATTG-3′ ...
-
bioRxiv - Microbiology 2023Quote: ... and cDNA generated using LunaScript® RT Supermix kit (NEB). qPCR was performed using Luna® Universal qPCR Master Mix (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1× ProtoScript II RT Reaction Buffer (New England Biolabs) was incubated for 1 h at 30°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 μl 10× Template Switching RT Enzyme Mix (NEB) were added to the mixture and the reaction was incubated at 42 °C for 90 min followed by 85 °C for 5 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... using the Luna Universal One-Step RT-qPCR Kit (NEB), and then analyzed with QuantStudio Design & Analysis Software v.1.5.1 ...
-
bioRxiv - Microbiology 2020Quote: ... a single-pot reaction was set up containing T4 ligase (10 000U) and buffer (NEB), SapI (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... a set of 5’-end biotinylated anti-sense DNA oligoes and 5ul RNase inhibitor (NEB) were added to the lysate ...
-
bioRxiv - Molecular Biology 2021Quote: ... sRNA libraries were constructed using NEBNext Small RNA Library Prep Set for Illumina (NEB E7330) and barcoded multiplex libraries were sequenced using Illumina MiSeq platform ...
-
bioRxiv - Molecular Biology 2020Quote: ... Libraries were prepared using NEBNext Small RNA Library Sample Prep Set (New England BioLabs (NEB), E7330 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Libraries were prepared using NEBNext Small RNA Library Sample Prep Set (New England BioLabs (NEB), E7330 ...
-
bioRxiv - Microbiology 2022Quote: ... The NEBNext® Multiplex Small RNA Library Prep Set for Illumina® (New England Biolabs) was used to generate the libraries for next generation sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA libraries were constructed using the NEBNext Small RNA Library Prep Set for Illumina (NEB) with 14 PCR amplification cycles ...
-
bioRxiv - Genomics 2024Quote: ... were then added using the NEBNext Sample Reagent Set (New England Biolabs, Ipswich, MA, USA) and purified using Ampure XP (Beckmann Coulter Genomics ...
-
bioRxiv - Plant Biology 2024Quote: ... The NEB Next® DNA Library Prep Master Mix set for Illumina kit (NEB #E6040S) was implemented to prepare the DAP-Seq gDNA library ...
-
bioRxiv - Developmental Biology 2021Quote: ... Mutagenic primers and the Q5 site-directed mutagenesis kit (NEB E0554S) were used to generate the BD-Chinmonon-stop and the CG11180/Chigno-sim* mutant ...
-
bioRxiv - Cell Biology 2020Quote: ... Unincorporated barcode primers were digested using Exonuclease I (New England Biolabs). cDNA was pre-amplified using KAPA HiFi HotStart polymerase (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: ... These four primers were designed using NEBuilder® Assembly Tool (NEB). psgaDC3XFLAG was obtained by ligating both amplicons using the Gibson Assembly® Cloning Kit (NEB) ...
-
bioRxiv - Biochemistry 2019Quote: ... Briefly: Library was amplified with Phusion Polymerase (NEB, #E0553L, primers below), in vitro-transcribed ...
-
bioRxiv - Cell Biology 2021Quote: ... Excess primers were removed from the samples by Exonuclease I (NEB) treatment ...
-
bioRxiv - Neuroscience 2021Quote: ... Barcoded primers were removed with exonuclease I treatment (NEB; 30 min) and subsequently bead/size selection of RT/PCR products (TotalPure NGS ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were treated with exonuclease I to removed primers (NEB, M0293L) and diluted 20-fold in Tris-EDTA ...
-
bioRxiv - Physiology 2022Quote: ... and indexed multiplex primers for Illumina sequencing (New England Biolabs, E7335). The PCR cycle number for each library amplification was optimized by running 10% of the library DNA in a real-time PCR reaction using Brilliant III Ultra-fast SYBR Green QPCR Master Mix (AH Diagnostic ...
-
bioRxiv - Neuroscience 2019Quote: ... the reverse primer AAAGGGATGTGGTGTTGGTG and Q5 polymerase (NEB; Cat. No. M0491S). The PCR products were ligated into the pBluescript II KS (+ ...
-
bioRxiv - Developmental Biology 2020Quote: ... NEBNext® Multiplex Oligos (dual index primers) (New England BioLabs, E7600) were used in the PCR enrichment step ...
-
bioRxiv - Immunology 2020Quote: Complementary DNA from single cells was generated using random primers (NEB) as previously described ...
-
bioRxiv - Molecular Biology 2023Quote: ... Bisulfite treated DNA was amplified using NEBNext index primers (NEB, E7335) and KAPA HiFi Uracil+ mastermix (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... 100nM each primer and 0.25μL of Phusion Polymerase (2000U/mL; NEB). PCR products were run on a 1% agarose gel to confirm desired length ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3.5 µL ddH2O and 1 µL 10 µM RTP primer (NEB) was added ...
-
bioRxiv - Molecular Biology 2023Quote: ... with Dual Index Primers (NEBNext® Multiplex Oligos for Illumina, NEB) following the manufacturer’s description ...
-
bioRxiv - Microbiology 2023Quote: ... MBTUni-13 primer (5’-ACGCGTGATCAGTAGAAACAAGG-3’) and Phusion Polymerase (NEB M0530L). PCR products were purified with PureLink PCR Purification Kit (Invitrogen K310002 ...
-
bioRxiv - Cell Biology 2023Quote: ... primer extension was performed with 0.006 U/μl Q5 (NEB, #M0491) and 200 μM each of dATP/dCTP/dTTP at 21°C for 10 min and an additional 15 min incubation with 25 nM recombinant human RPA (a gift from Sarah W ...