Labshake search
Citations for New England Biolabs :
901 - 950 of 1031 citations for Lassa Fever Virus GP1 Protein Mouse Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... The vector was transformed into BL21-DE3 cells and the protein purified using gravity flow amylose resin (New England Biolabs) affinity chromatography ...
-
bioRxiv - Genomics 2023Quote: Constructs encoding either a GFP or an RFP protein were PCR amplified and in-vitro transcribed from a T7 promoter with the HiScribe T7 Kit (NEB), using a mixture of ATP ...
-
bioRxiv - Synthetic Biology 2023Quote: Plasmids encoding RBC biosensor proteins were assembled using standard molecular biology techniques of PCR and restriction enzyme cloning with Phusion DNA Polymerase (NEB), restriction enzymes (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... lysate volume equivalent to 20-40 µg total protein was first denatured at 100°C for 10 min in 1X glycoprotein denaturation buffer (NEB). Endo H digestion was performed at 37°C for 1h in the presence of 1X GlycoBuffer 3 and 1 µL of Endo H enzyme (NEB) ...
-
bioRxiv - Biochemistry 2023Quote: ... four cycles of RD were performed using the PureExpress in vitro protein synthesis kit (New England Biolabs, Ipswich, MA, USA) for in vitro transcription and translation ...
-
bioRxiv - Plant Biology 2023Quote: ... and AT1G66100 which encode a PR (pathogenesis-related) protein were amplified using the Phusion High-Fidelity DNA Polymerase (New England Biolabs) from Col-0 genomic DNA with two primer pairs RBCS2B-BglII-PF (5′-CCAGATCTGGAATATTCAATGTTGACTATC-3′ ...
-
bioRxiv - Molecular Biology 2023Quote: ... by replacing the green fluorescent protein (GFP) with a mCherry reporter using the NEBuilding HiFi DNA Assembly Cloning Kit (New England Biolabs) (Ran et al. ...
-
bioRxiv - Neuroscience 2023Quote: RNA was released from the beads through protein K lysis (Monarch® Total RNA Miniprep Kit; New England Biolabs, #T2010S). After lysis ...
-
bioRxiv - Biochemistry 2023Quote: ... Cleared lysate containing the nucleosomes was incubated with purified MBP-tag or MBP-FoxP3ΔN protein (1uM) for 1 hour at 4℃ and then subjected to MBP pulldown using Amylose Resin (New England Biolabs). After proteinase K (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... TIS11B protein-RNA complexes were immunoprecipitated from 1 ml of crosslinked lysate and washed with high salt and PNK buffer (NEB). RNA was repaired by 3′ dephosphorylation and ligated to L3-IR adaptor on beads ...
-
bioRxiv - Molecular Biology 2023Quote: Expression vectors encoding His6/SUMO-tagged SAHS proteins were obtained from Twist Bioscience and transformed into LEMO21(DE3) competent cells (New England Biolabs) according to the provider’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Coli vectors expressing SAHS proteins without SUMO tags were ordered and synthesized from Twist Bioscience and transformed into LEMO21(DE3) competent cells (NEB). To test for the effects of intracellular SAHS expression ...
-
bioRxiv - Cell Biology 2023Quote: ... myc-tagged AP3B1 immunoprecipitated and immobilised on Protein G-sepharose beads was incubated with CK2 (250 units; New England Biolabs) for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... the reaction was stopped with a final concentration of 50 mM EDTA and the proteins were removed by treatment with proteinase K (1/100 of the volume – NEB) and SDS (0.1% ...
-
bioRxiv - Genomics 2024Quote: Each of the fragmented protein factor-enriched chromatin sample was mixed with 50 µg/ml of BSA (cat# B9000S, NEB) to prevent chromatin aggregation ...
-
bioRxiv - Microbiology 2024Quote: ... reactions were performed in a final volume of 100 μl using the PURExpress ΔRibosome In vitro Protein Synthesis Kit (New England Biolabs) according to the manufacturer instructions and with ribosomes purified from E ...
-
bioRxiv - Plant Biology 2024Quote: ... in an N-terminal fusion (MIROs are tail anchored proteins) with mCherry that was generated by Gibson assembly (New England Biolabs, Ipswich ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 40 – 50 µg of protein lysate from each sample was denatured in 1X Glycoprotein Denaturing Buffer (Cat.#B1704S; New England Biolabs) with 20 µL total volume at 100°C for 10 min ...
-
bioRxiv - Biochemistry 2024Quote: In vitro translation was monitored by the production of luciferase signal in a PURExpress in vitro protein synthesis kit (NEB), using firefly luciferase mRNA as an input ...
-
bioRxiv - Cell Biology 2024Quote: ... under a CamKII promoter were both restriction digested with AgeI and the HALO protein was ligated with Quick Ligase (NEB) into the ER-GCaMP yielding the CamKII ER-Halo-GCaMP6-150 ...
-
bioRxiv - Biochemistry 2024Quote: ... a pET-derived vector that is normally used for T7 RNA polymerase-dependent protein expression (AVA421) was linearized by digestion with XbaI (NEB) in a reaction containing 1X CutSmart buffer and 0.5 U/μl XbaI to be used for run-off transcription using T7 RNA polymerase to transcribe the first 26 nucleotides following the T7 promoter sequence to generate the standard model RNA substrate ...
-
bioRxiv - Bioengineering 2024Quote: ... and mCherry inserts were generated via PCR and cloned into the linearized viral backbone as a single fusion protein using HiFi cloning mix (NEB). H2B-iRFP nuclear marker was (Addgene Plasmid #90237) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Template DNA for in vitro protein synthesis was generated with Phusion® Hot Start Flex DNA Polymerase (NEB. Ipswich MA) using gBlocks as template and flanking primers (Supplementary Table S2) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bound antibodies were detected by incubation with anti-rabbit or anti-mouse DyLight 800-conjugated secondary antibodies (New England BioLabs). Slide images were acquired using an InnoScan 710-IR scanner (Innopsys ...
-
bioRxiv - Immunology 2021Quote: ... A mouse SUV39H1 gBlock was synthesized (IDT) and cloned into AgeI/BSpEI-digested pL-SFFV-RFP using Gibson assembly (NEB) for 1hour at 50°C ...
-
bioRxiv - Cell Biology 2022Quote: The DNA sequence coding for full length of p21 and Cyclin B1 was amplified from mouse cDNA by PCR using Phusion high-fidelity DNA Polymerase (New England BioLabs) and cloned in frame into Ch plasmid with AsiSI and NotI restriction endonucleases (New England BioLabs) ...
-
bioRxiv - Genomics 2020Quote: ... The protocol started with tissue pre-permeabilization (30 min at 33°C for mouse brain) with addition of 120μl reagent per well of exonuclease I buffer (NEB, USA). In case spleen sections were processed ...
-
bioRxiv - Neuroscience 2019Quote: ... Secondary antibodies used were: Alexa-680 goat anti-mouse IgG and Alexa-800 goat anti-rabbit IgG (New England Biolabs). For DRGN cultures ...
-
bioRxiv - Molecular Biology 2019Quote: Libraries were prepared with NEBNEXT rRNA Depletion kit (human/mouse/rat) and NEBNEXT Ultra II Directional RNA Library Prep kit for Illumina (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: The CAG-HA-RBMS3-PCDH cDNA expression plasmid was cloned using a cDNA template made from RNA from the lungs of a wild-type mouse using the Q5 polymerase (NEB) and restriction endonuclease cloning with the following primers ...
-
bioRxiv - Neuroscience 2021Quote: ... One piece of mouse frontal cortex tissue (6-10 mg) was placed in 3 ml of ice-cold nuclei extraction buffer (NEB) [0.32 M sucrose ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 μg of total RNA was depleted of rRNA using NEBNext rRNA Depletion Kit (Human/Mouse/Rat) prior to cDNA synthesis primed with random hexanucleotide oligonucleotides (Random Primer 6, NEB). Sequencing library construction was carried out using NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Cell Biology 2019Quote: ... Standard qualitative PCRs to check for the general abundance of distinct SPIRE1 splice variants were performed employing cDNAs from mouse brain tissue and Q5 High-Fidelity DNA polymerase (New England Biolabs). Expression vectors encoding mouse SPIRE1 ...
-
bioRxiv - Immunology 2020Quote: ... Single antigen specific memory B cells were sorted on BD FACS Aria II into 96-well PCR plates (Axygen) containing 10 μl per well of lysis buffer (10 mM DPBS, 4 U Mouse RNase Inhibitor, NEB). Plates were immediately frozen on dry ice and stored at 80 C or processed for cDNA synthesis.
-
bioRxiv - Neuroscience 2023Quote: ... To generate these constructs gene block fragments that codify for those sequences were produced in the Duke Transgenic Mouse Facility and cloned into the backbone using EcoRI-HF Restriction Enzyme (NEB) and In-Fusion HD Cloning Kit (Takara ...
-
bioRxiv - Immunology 2023Quote: ... The custom sgRNA vector used in this study was a hybrid AAV-SB-CRISPR plasmid for targeting primary mouse NK cells (AAV-SB100x) that was constructed by gBlock fragments (IDT) followed by Gibson Assembly (NEB). The Surf-v2 library was cloned into the AAV-SB-CRISPR vector by pooled cloning to generate the AAV-SB-Surf-v2 plasmid library.
-
bioRxiv - Molecular Biology 2023Quote: ... The corresponding regions of a partial mouse Azin1 gene were amplified from mouse tail genomic DNA by using Phusion Hot Start Flex 2X Master Mix (New England Biolabs) and the following primers ...
-
bioRxiv - Cancer Biology 2022Quote: ... rRNA depletion was performed using a NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) and RNA was purified using Agencourt RNAClean XP Beads (New England Biolabs). Libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) ...
-
bioRxiv - Immunology 2024Quote: N-linked glycans were enzymatically released from purified mouse THP using PNGase-F kit (catalog no P0709S, New England Biolabs). N-glycans were then purified from the reaction mixture containing denaturing buffer and de-N-glycosylated proteins by solid phase extraction method using Sep-Pak C18 (1 cc Vac-cartridges ...
-
bioRxiv - Microbiology 2024Quote: ... AnTat1.1 sequence was obtained from AnTat1.1 specific cDNA from mouse infection D6 cloned into a pMiniT vector with the PCR Cloning Kit (NEB, E1202S). VSG-228 was partially amplified from VSG PCR (see below ...
-
bioRxiv - Molecular Biology 2019Quote: ... of pA-Dam protein was incubated with 500 ng of unmethylated plasmid in 20 µL of 1x dam MethylTransferase buffer (New England BioLabs #M0222S) supplemented with 80 µM S-adenosylmethionine (SAM ...
-
bioRxiv - Biochemistry 2020Quote: In vitro trans-translation assays were performed using the PURExpress In Vitro Protein Synthesis and Δ Ribosome kits (New England Biolabs). For trans-translation assays ...
-
bioRxiv - Genomics 2021Quote: ... Samples were then combined and AMII adapters containing the motor proteins needed for sequencing were ligated using NEBNext® Quick Ligation Module (NEB). AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Biochemistry 2020Quote: ... Beads were resuspended in 1 volume of buffer A / 300 mM NaCl / 2 mM MnCl2 / 1 mM DTT and incubated with λ protein phosphatase (NEB) at 50 U / mL for 1 hour at 23°C with agitation ...
-
bioRxiv - Biochemistry 2021Quote: ... The RNAs were recovered from the gel slices by digesting the protein with proteinase K (8 U; P8107S, NEB, Ipswich, MA) leaving a polypeptide remaining at the crosslinked nucleotide ...
-
bioRxiv - Plant Biology 2020Quote: 20-33 kD subregions of NRPD1 and RDR2 polypeptides were expressed in vitro using a PURExpress® In Vitro Protein Synthesis Kit (New England Biolabs). Briefly ...
-
bioRxiv - Immunology 2022Quote: Single mutations of the spike protein were generated via two PCR fragments of the spike ORF using high-fidelity Phusion polymerase (New England Biolabs, USA). The first fragment was generated via a generic forward primer (pCAGGS-5 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... a total of 575 embryos were injected with a mixture containing 300 ng/μL of sgRNA (one guide) and 600 ng/μL of Cas9 protein (NEB, M0641) while for Dll ...
-
bioRxiv - Microbiology 2022Quote: ... The SARS-CoV-2 Spike mutant D614G was generated by site-directed mutagenesis using as an input DNA the expression vector encoding SARS-CoV-2 Spike_614D protein (kindly provided by J. Garcia-Arriaza, CNB-CSIC) by Q5 Site Directed Mutagenesis Kit (New England Biolabs, Barcelona, Spain) following the manufacturer’s instructions ...