Labshake search
Citations for New England Biolabs :
901 - 950 of 1757 citations for 6 FORMYL 2 THIOURACIL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... primers MR161 and MR162 (Table 2) were phosphorylated with T4 Polynucleotide Kinase (New England Biolabs) at 37°C for 1 h in a 4.5 μl reaction volume with 10 μM primer ...
-
bioRxiv - Immunology 2020Quote: ... to generate Cap 0 and in some cases also the Vaccinia 2’ O methyltransferase (NEB) to generate Cap 1 ...
-
bioRxiv - Genomics 2022Quote: ... Each PCR#2 reaction contained 25 µL of Q5 High-Fidelity 2X Master Mix (NEB), 2.5 µL of a unique Nuc PCR#2 Fwd Primer (10 µM) ...
-
bioRxiv - Immunology 2022Quote: PCRs were done with the Q5 Hot-start 2× master mix (New England BioLabs, NEB), and cloning was performed using the Gibson Assembly 2× Master Mix (NEB ...
-
bioRxiv - Immunology 2022Quote: PCRs were done with the Q5 Hot-start 2× master mix (New England BioLabs, NEB), and cloning was performed using the Gibson Assembly 2× Master Mix (NEB ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 5 μl of the resulting amplicon were diluted 1:4 in 1x buffer 2 (NEB), followed by denaturation and re-annealing in a nexus GSX1 Mastercycler (Eppendorf ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was removed by adding 2 μL DNaseI and 5 μL 10x DNase buffer (NEB) to the purified RNA and incubated at 37C for 30 minutes ...
-
bioRxiv - Bioengineering 2019Quote: ... LAMP mix contained 10 µL 2×WarmStart LAMP Mastermix (New England Biolabs, Ipswich, MA, USA) and 6 µL water ...
-
bioRxiv - Cancer Biology 2021Quote: ... for 1 h followed by incubating with 2 μL Proteinase K (New England Biolabs, USA) at 65 °C ...
-
bioRxiv - Bioengineering 2021Quote: ... The sample was chilled to halt the denaturation process and GlycoBuffer 2 (New England Biolabs), NP-40 ...
-
bioRxiv - Molecular Biology 2020Quote: 3’ linker ligation (1x PNK buffer, 800 u T4 RNA ligase 2 truncated KQ (NEB), 80 u RNaseOUT ...
-
bioRxiv - Biochemistry 2021Quote: ... recombinant SARS-CoV-2 Omicron RBD was digested with EndoH over night (New England Biolabs). Recombinant hACE2 protein was digested using EndoH (New England Biolabs ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 ug of DNA was treated with uracil DNA glycosylase (UDG, New England Biolabs, Inc.) for 60 minutes at 37°C with gentle shaking ...
-
bioRxiv - Genomics 2022Quote: ... and NEBNext Multiplex Oligos for Illumina Index Primers Sets 1 and 2 (NEB E7335S & E7500S). In order to increase input DNA above single library limits (1 μg ...
-
bioRxiv - Microbiology 2022Quote: ... Sequencing libraries were prepared using the NEBNext ARTIC SARS-CoV-2 Library Prep Kit (NEB) and ARTIC V3 (MHome ...
-
bioRxiv - Microbiology 2023Quote: ... a fragment including the SARS-CoV-2 RdRp catalytic residue was subcloned into pUC19 (NEB) and the resulting pUC19-RdRp was mutated at the RdRp catalytic residue by inverse PCR using mutation-introducing primers (Supplementary Table 1) ...
-
bioRxiv - Microbiology 2022Quote: ... and library preparation was performed using the NEBNext ARTIC SARS-CoV-2 FS kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... PCR amplicons encompassing exon 2 of SERINC3 were produced using Taq 2x Master Mix (NEB) and the following primers ...
-
bioRxiv - Biochemistry 2023Quote: ... Total RNA (2 µg) was first annealed with 200 ng random nonamer primers (NEB S1254S) by incubation at 70°C for 5 min ...
-
bioRxiv - Cell Biology 2023Quote: ... The cutting vector GW223_pX330A_sgX_sgPITCh (2 μg) was digested with BbsI-HF (New England Biolabs; #R3539) in Cutsmart Buffer (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... For AsiSI digestion, samples were equilibrated (2 min, RT) in 150 µL CutSmart buffer (NEB). 3µl recombinant AsiSI endonuclease (10U/µL ...
-
bioRxiv - Molecular Biology 2023Quote: ... samples were incubated with 1.5 µl EndoH and 2 µl 10× GlycoBuffer 3 (all NEB) buffer at 37°C 1h ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μL of each ATAC-seq library was added to 2x NEBNext Master Mix (NEB) and 0.4x SYBR Green (Thermo Fisher ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR reactions were performed by combining 12.5 µL Q5 high-fidelity 2× master mix (NEB), 2.5 µL each of 10 µM forward and reverse primers ...
-
bioRxiv - Genomics 2022Quote: ... were enriched from total RNA using the SARS-CoV-2 / TBRV MagIC beads (ElementZero Biolabs) according to the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2023Quote: ... PCR amplified Domain 1 and PCR Domain 2 and HiFi DNA assmbley was performed (NEB). Transformation was performed in DH5α cells (REF) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μg of gRNA was mixed with 3.3 μL of Spy Cas9 NLS (NEB, UK) and incubated for 30 min at RT ...
-
bioRxiv - Immunology 2023Quote: ... After digestion the linearized backbone was dephosphorylated by addition of 2 µl rSAP (NEB, #M0371S) and incubation at 37 °C for 1 hour followed by heat inactivation of the enzymes at 80 °C for 20 minutes ...
-
bioRxiv - Systems Biology 2023Quote: ... 2) the CYC terminator by digesting pDL00212 with HindIII-HF (New England Biolabs, Ipswitch, MA) and SpeI-HF (New England Biolabs ...
-
bioRxiv - Cell Biology 2024Quote: ... RNF43 mutants were generated by PCR-subcloning using Q5 High-Fidelity 2× Master Mix (NEB). Domain swapped constructs were generated by in-fusion cloning (Takara Bio) ...
-
bioRxiv - Immunology 2024Quote: ... Purified round 2 PCR products were cloned using the NEB PCR Cloning Kit (NEB, #E1202) and sequenced with Sanger sequencing.
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: ... Samples were cooled to 42 °C and 2 μl of β-agarase I enzyme (NEB) was added and incubated at 42 °C for 90 min with occasional vortexing ...
-
bioRxiv - Bioengineering 2024Quote: ... 2) parts were either synthesized as fragments (Twist Bioscience) and subsequently PCRed using Q5 (NEB), or synthesized as duplex oligos (IDT) ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the manufacturer’s protocol or with radioactive labeling mix (1 µL 10x PNK buffer, NEB, 1 µL of 100 µM gapmer, 1 µL T4 PNK, NEB, 1 µL γ-32P-ATP, Hartmann, 6 µL ddH2O) for 40 min at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... the SNAP-tag fragment was digested from the pSNAP-tag (T7)-2 vector (New England Biolabs), inserted into pET-28b plasmid resulting in a construct referred as pET-SNAP ...
-
bioRxiv - Cell Biology 2019Quote: ... the HeLa cells were kept in HeLa culture media treated overnight with 0.2 U/mL of □2-3,6,8,9 Neuraminidase (New England Biolabs) to cleave sialic acid from the cell surface glycans.
-
bioRxiv - Cell Biology 2020Quote: ... and 2) the insert and pcDNA5-FRT-TO were digested with 40U of EcoRV-HF (NEB) and 40U of XhoI (NEB).
-
bioRxiv - Cell Biology 2020Quote: ... peak fractions pooled and reacted with 2-molar excess SNAP-substrate Alexa-488 dye (S9129, NEB) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Molecular Biology 2021Quote: ... The nuclei were harvested and resuspended in 0.5ml cold 1.2x NEB Buffer 2 (New England Biolabs), incubated with 0.3% SDS for 1 hr at 37°C ...
-
bioRxiv - Genomics 2022Quote: ... 10 μl 2X Quick T4 ligase buffer and 2 μl Quick T4 DNA ligase (NEB, M2200L) were added to the reaction and incubate at 37 °C for overnight ...
-
bioRxiv - Genomics 2020Quote: ... 66U/μl truncated T4 ligase 2 and 13U/μl murine RNAse inhibitor (all from NEB, USA)) were added to the aRNA/adapter solution ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ...
-
bioRxiv - Genomics 2019Quote: ... was ligated to the 3’-ends of the RNA using T4 RNA Ligase 2 (NEB #M0242L) in presence of PEG 8000 (2.5% w/v) ...
-
bioRxiv - Molecular Biology 2019Quote: ... in the presence of Quick Ligase enzyme and 2× Quick Ligase Reaction buffer (New England BioLabs). Before transfer to the yeast ...
-
bioRxiv - Developmental Biology 2019Quote: Pceh-23_L::acy-2 fragment(anti-sense) was generated with a Gibson assembly cloning kit (NEB) by assembly of the following two DNA fragments ...
-
bioRxiv - Cancer Biology 2019Quote: ... was ligated to the RNA fragments on bead using T4 RNA ligase 2 truncated KQ (NEB M0373 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 10 µl of PCR product was then mixed with 1.5 µl 10X NEBuffer 2 (B7002S, NEB) and 1.5 µl of Nuclease-free water ...
-
bioRxiv - Biochemistry 2021Quote: ... This was added to 5 ml (per 2 L of culture) amylose resin (New England Biolabs) equilibrated in lysis buffer and left on a tube roller shaker at 4 °C for 1 h ...
-
bioRxiv - Plant Biology 2021Quote: ... using BamHI and XhoI restriction sites and 2× Gibson Assembly master mix (NEB, Ipswich, MA, USA) according to the manufacturer’s instructions ...