Labshake search
Citations for New England Biolabs :
901 - 950 of 2691 citations for 5 Isoxazolemethanol 3 3 fluorophenyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Either the wild-type or the mutant version of the PRNP 3’U R were inserted into the digested pmirGLO vector by performing a Gibson Assembly following manufacturer`s instructions (NEB). After transformation of the cloned vectors and purification of the DNA using EndoFree Plasmid Maxi Kit (Qiagen) ...
-
bioRxiv - Biophysics 2020Quote: ... for 2 h at 37°C and IFITM3-iSNAP was stained with 3 µM SNAP-cell 647-SIR (New England Biolabs) at the same time ...
-
bioRxiv - Bioengineering 2021Quote: ... The flow cell was washed with water 3 times and then loaded with EcoRI-HF cocktail (1U EcoRI-HF (R3101, NEB) in 1X CutSmart NEB buffer ...
-
bioRxiv - Plant Biology 2021Quote: ... and 3 kb of upstream sequence containing the promoter was amplified from Arabidopsis genomic DNA using Phusion polymerase (New England Biolabs) using flanking primers and then the primers RSH1-F (TCCGTCTTGTCTGAATCAGCT ...
-
bioRxiv - Plant Biology 2021Quote: ... and the 3’ UTR sequence (310 bp downstream of the stop codon) were amplified by PCR using Phusion DNA polymerase (NEB) from genomic Col-0 DNA with IRT1p_-1024F 5’- CACCGACACATTAAACATTCATACCCGATT-3’ and IRT1_1546R 5’- CTTTAATTTACTTATCTTGAAAAAGCAGC-3’ ...
-
bioRxiv - Microbiology 2020Quote: ... The RNA fragments were ligated with 3’-barcoded adaptors at 22 °C for 1 h and 30 min using T4 RNA Ligase (NEB). Barcoded RNA samples were pooled together ...
-
bioRxiv - Microbiology 2020Quote: ... designed to bind upstream of the polyA- tail at the 3’ end of the genome and dNTPs (10 mM, NEB), and incubated at 65 °C for 5 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNAs were isolated from Calu-3 infected cells 48h post infection using the Luna Cell Ready Lysis Module (New England Biolabs). Viral RNA were quantified by qRT-PCR in triplicate as described in [27] ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pmex-5::PH-GFP-cyk-1(700-1437)::tbb-2 3’UTR in the pCFJ150 backbone [89] was made using HiFi cloning (New England Biolabs). Notably ...
-
bioRxiv - Biochemistry 2021Quote: ... The reaction was stopped with the addition of 0.2% SDS and 3 units of Proteinase K (New England Biolabs, #P8107S), and incubated for 1 hr at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... and then ligated to pre-annealed double-stranded adaptors that contain single dT overhangs and a unique molecular identifier (UMI) consisting of a randomized 8-base sequence containing a 3-base specific barcode by T4 DNA ligase (NEB) overnight at 15 °C ...
-
bioRxiv - Microbiology 2020Quote: ... Linkers (5’-ACTAGTTCCGAGCTCGAG-3’) with restriction sites for SpeI and XhoI were introduced by PCR based mutagenesis using the Q5 mutagensis kit (NEB) after codon 466 of nsP2 (2EGFP ...
-
bioRxiv - Cell Biology 2021Quote: ... 50 ng of vector and 150 ng of each fragment were mixed with 3 μl of HiFi DNA Master Mix (NEB) and incubated at 50°C for 1 hour to form the new pCDH-TagBFP-T2A-myc-BirA*-Tensin3 construct ...
-
bioRxiv - Neuroscience 2022Quote: ... Mutation of the verified 7-mer binding site of the 3’-UTR of Zfp36l1 was performed using the Q5-site directed mutagenesis kit (New England BioLabs) using the following primers ...
-
HNRNPA2B1 controls an unfolded protein response-related prognostic gene signature in prostate cancerbioRxiv - Cancer Biology 2022Quote: ... was combined with forward and reverse primers (Supplementary Table 3) and the Luna Universal qPCR Master Mix master mix (M3003, NEB) containing SYBR green and ROX passive dye to a final 10ul reaction volume ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2019 [36] with the modification that 3 µg of gDNA per technical replicate were digested using Nucleoside Digestion Mix (NEB M0649S ...
-
bioRxiv - Molecular Biology 2022Quote: The regions of interest (supplementary Table 1) were PCR amplified (supplementary table 3) from the extracted DNA using Q5 high-fidelity DNA polymerase (NEB). Of the primers used in the PCRs (supplementary table 2 ...
-
bioRxiv - Physiology 2022Quote: ... while an additional step which added 3’ A-overhangs to the slc15a2a purified PCR product was performed using Taq DNA polymerase (New England Biolabs) before cloning into pCR4-TOPO vector (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: ... One piece of mouse frontal cortex tissue (6-10 mg) was placed in 3 ml of ice-cold nuclei extraction buffer (NEB) [0.32 M sucrose ...
-
bioRxiv - Biochemistry 2020Quote: ... the human Rab1b 3-174aa (referred to as Rab1b)-encoding DNA was cloned into a modified pMAL vector (New England Biolabs), resulting in a construct with a N-terminal hexahistidine (6xHis ...
-
bioRxiv - Plant Biology 2021Quote: ... the RNA was subsequently ligated to an RNA adapter with a 3’ phosphate group by RtcB ligase (#M0458S, New England Biolabs). The ligated RNA was converted to cDNA with RevertAid first strand cDNA synthesis kit (#K1612 ...
-
bioRxiv - Microbiology 2021Quote: ... The protruding 3’ ‘A’ base was then used for ligation with the NEBNext Multiplex Oligos for Illumina (New England Biolabs) which have a single 3’ overhanging ‘T’ base and a hairpin structure ...
-
bioRxiv - Neuroscience 2020Quote: ... according to the manufacturer’s recommendations and subjected to ligation (2h at RT) with a pre-adenylated 3’ linker (2µM final) and a truncated T4 ligase (NEB M0373L). Ligated RPFs of 50 – 70 nucleotides (nt ...
-
bioRxiv - Plant Biology 2021Quote: ... Flanking sequences 5’ and 3’ of the coding regions were amplified with appropriate primer pairs (Table S2) using Phusion DNA polymerase (New England Biolabs) and cloned into pDONR 221 P1-P4 and pDONR 221 P3-P2 ...
-
bioRxiv - Microbiology 2020Quote: ... Dephosphorylated RNA-protein complexes were then rinsed once with NT2 buffer and 3’-end ligated with T4 RNA Ligase 1 (NEB) overnight in an Eppendorf Thermomixer at 16°C ...
-
bioRxiv - Microbiology 2020Quote: ... A-tails were added to the 3′ ends of the DNA by incubating the beads with Klenow fragment (exo-) (NEB) in a 100 μL reaction ...
-
bioRxiv - Cell Biology 2020Quote: ... Four hundred ng of total RNA extracted from pools of 250 mouse oocytes was ligated to 400 ng of P1 anchor primer (5’-P-GGT CAC CTT GAT CTG AAG C-NH2-3’) in a 10-µl reaction using T4 RNA ligase (New England Biolabs) for 30 min at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... and poly(G) tails were added at the 3’ end of the purified ssDNA by terminal transferase (New England Biolabs). The double-stranded DNA was then synthesized and amplified by PCR from the poly(AG)-tailed ssDNA using the primers BLV-F2 and NV-oligo-dT-ADP1 and Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs) ...
-
bioRxiv - Genomics 2022Quote: ... 3’UTR fragment was assembled into a plasmid (VRQRABE-mRNA plasmid) using NEBuilder HiFi DNA Assembly Master Mix (NEB, E2621S) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... 40 μL of each digest product were then ran on a 3% agarose gel and the appropriate band was gel extracted using a kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... 40 μL of digest product was then ran on a 3% agarose gel and the appropriate band was gel extracted using a kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... The lyophilized peptides were resuspended in 200 µl of 50 mM ammonium bicarbonate to which 3 µl of PNGaseF (New England Biolabs) were added for a 4h incubation at 37C ...
-
bioRxiv - Molecular Biology 2019Quote: ... Amplified vector and insert (1:3 ratio) were assembled in 20 µl Gibson reaction (61) as per manufacturer’s instructions (NEB, USA) and 2 µl was transformed into chemically competent E ...
-
bioRxiv - Cell Biology 2019Quote: ... we introduced flanking FRT sites 104bp upstream of the transcription start site and 99bp downstream of the end of the 3’UTR using a Q5 Site-Directed Mutagenesis kit (New England Biolabs) and the following primers:
-
bioRxiv - Molecular Biology 2019Quote: ... The resulting PCR product was ligated to the EcoRI-SbfI digested pLs-mP backbone in 3 separate Gibson assembly reactions (HiFi DNA Assembly, NEB). 2 µL of each Gibson assembly reaction were transformed into Stbl4 electrocompetent E ...
-
bioRxiv - Genomics 2019Quote: ... Ligation of pJDrcEPP_lib and minP-Luc2 inserts was performed at a 1:3 ratio as before but with T7 DNA ligase (New England Biolabs). Ligation product was cleaned-up and transformed as before ...
-
bioRxiv - Bioengineering 2019Quote: ... with 3, 6, or 12 nM iSpinach DNA (IDT, USA, Ultramers) template in transcription buffer (1x RNAPol Reaction Buffer (NEB, No ...
-
bioRxiv - Microbiology 2019Quote: ... followed by heat inactivation for 10 min at 80°C and overnight ligation at a 1:3 vector-to-insert ratio using T4 DNA Ligase (NEB) at 4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... To visualize SNAP-tagged dCENP-A proteins cells were labelled with 3 µM SNAP-Cell TMR Star (New England Biolabs) for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... The AP-3 sorting mutant was regenerated in MigR1-PI4KIIα-GFP using the Q5 site-directed mutagenesis kit (New England Biolabs) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Bacterial lysis was completed by incubating for 3 h at 55°C in the presence of 1% SDS and 100 μg/ml proteinase K (NEB). Lysates from both methods were extracted twice with equal volumes of phenol– chloroform–isoamyl alcohol (25:24:1) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The targeted genomic locus was then PCR amplified with primers flanking the expected cutting site (Supplementary Table 3) using Q5 Hot Start High-Fidelity Polymerase (NEB). 5 μl of the resulting amplicon were diluted 1:4 in 1x buffer 2 (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... was digested with PmeI and SacII restriction enzymes for 3 to 4 hours at 37°C and dephosphorylated using Antarctic Phosphatase (NEB) for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... before resuspending the beads in 25 μl RNA ligation mix (9 μl H2O, 3 μl 10x T4 RNA ligase buffer (NEB), 0.3 μl 0.1M ATP ...
-
bioRxiv - Genomics 2020Quote: ... Purified fragments were mixed at 1:3 molar ratio and assembled with NEBuilder HiFi DNA Assembly Mater Mix (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... was amplified by PCR using primers motAB-Fwd-KpnI and motAB-rev-SacI (Table S2) and ligated into plasmid pBBR1MCS-3 after restriction with enzymes SacI and KpnI (NEB). Ligation products were transformed into E ...
-
bioRxiv - Cell Biology 2019Quote: ... gR1 AIP5-3309 and gR2 AIP5-3309 primers were designed based on this tool and hybridized at a concentration of 3 µM in 1×T4 DNA ligase buffer (NEB) by initial heating and subsequent cooling steps ...
-
bioRxiv - Genetics 2019Quote: ... The repair templates were made by annealing oligos in Table S3 and extending the 3’ ends using Phusion Polymerase (New England Biolabs). The pol30-6 (D41A ...
-
bioRxiv - Genomics 2019Quote: ... samples were digested with 10 U pshAI in 1x CutSmart buffer at 37°C for 3 or more hours (NEB).
-
bioRxiv - Molecular Biology 2019Quote: ... 100 pmol of the oligonucleotides 5’-ATTGTCATACCGATCCCAATTCGA-3’ and 5’-AAACTCGAATTGGGATCGGTATGAC-3’ were phosphorylated for 30 min at 37 °C using 1 mM ATP and 1 unit polynucleotide kinase (NEB) in the buffer supplied by the manufacturer and then hybridized in a thermocycler (5 min 95 °C ...