Labshake search
Citations for New England Biolabs :
9351 - 9400 of 10000+ citations for Human Dachshund Homolog 1 DACH1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Sequencing libraries were generated using NEBNext® UltraTM II DNA Library Prep Kit for Illumina® (New England Biolabs, MA, USA) and index codes were added ...
-
bioRxiv - Immunology 2020Quote: ... Purified DNA was subjected to ChIP-Seq library preparation with NEBNext Ultra II DNA Library Prep Kit for Illuumina (NEB, #E7645) and sequenced by paired-end 75-bp sequencing on Next-Seq550 ...
-
bioRxiv - Microbiology 2021Quote: ... RNA quality was assessed using the Agilent Bioanalyzer and appropriate samples were used for NGS library preparation with the NEBNext Ultra II Directional RNA kit (NEB E7760) and sequenced with 50 bp paired-end reads and 30 mio reads per sample on the Illumina HiSeq 2500 ...
-
bioRxiv - Microbiology 2021Quote: ... Yields of viral RNA were quantified by real-time qPCR by using SARS-CoV-2 specific primers targeting the E gene with the Luna®Universal One-Step RT-qPCR Kit (New England Biolabs) in a LightCycler 480 thermocycler (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... were subcloned into phCMV3 to express C-terminal FLAG-tagged CatSper subunits (phCMV3-CatSperd or z-Flag) using NEBuilder® HiFi DNA Assembly Kit (NEB). A stop codon was placed at the upstream of HA-encoding sequences of phCMV3 vector for FLAG-tagged CatSper subunit cloning.
-
bioRxiv - Developmental Biology 2021Quote: ... High-throughput sequencing libraries from ChIP and input DNA were prepared using NEBNext Ultra DNA Library Prep Kit (New England Biolabs, E7370S). During library preparation ...
-
bioRxiv - Developmental Biology 2020Quote: ... and libraries were prepared using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB; E7760), as directed by the manufacturer ...
-
bioRxiv - Plant Biology 2021Quote: ... excised and gel extracted using the Monarch DNA Gel Extraction Kit following the manufacturers’ instructions (New England BioLabs; Ipswitch, MA, USA).
-
bioRxiv - Plant Biology 2021Quote: ... from each sample were used to construct the DNA libraries using a NEBNext Ultra DNA Library Prep Kit for Illumina (NEB, USA) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... 100 ng of rRNA-depleted RNA was subsequently used for library preparation using NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs, E7420S) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: Whole-genome enzymatic methyl-seq libraries were prepared using the NEBNext® Enzymatic Methyl-seq kit (New England BioLabs®, Inc.) following the protocol for standard insert libraries (370-420 base pairs) ...
-
bioRxiv - Microbiology 2021Quote: ... the purified DNA was used as library construction with the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, E7645L). High-throughput sequencing was carried out using Illumina Hiseq-PE150 by Novogene Corporation (Beijing ...
-
bioRxiv - Molecular Biology 2021Quote: ... 100 ng rRNA-depleted RNA from each nuclear fraction was used with the NEBNext Ultra II Directional library kit (NEB E7760S) to prepare RNA-seq libraries ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were constructed with the NEBNext RNA Ultra II Library Prep Kit for Illumina (New England Biolabs, Ipswich, Massachusetts, United States) from 1 µg of purified RNA according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Library preparation of immunoprecipitated DNA fragments was performed using NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs: E7645) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... coli culture grown in LB supplemented with 100 μg/ml carbenicillin (LB+CA100) via miniprep kit (New England Biolabs, cat#T1010S). The plasmid was transformed into chemically competent E ...
-
bioRxiv - Molecular Biology 2019Quote: ... insertion of GLuc and chimera of CBD were introduced into the flavivirus NS1 constructs (DENV, ZIKV, YFV) using Q5® Site-Directed Mutagenesis Kit (NEB) used according manufacturer’s instructions.
-
bioRxiv - Neuroscience 2020Quote: ... and Thr205Ala) were introduced individually to ItypOR46 in pcDNA5™/TO using the Q5 Site-Directed Mutagenesis kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: NRSF/REST fragments as well as the linearised backbone vector were assembled in an isothermal Gibson assembly reaction (Gibson Assembly® Cloning Kit, New England BioLabs) following the manufacturer’s instructions (Figure S4C ...
-
bioRxiv - Neuroscience 2021Quote: ... non-stranded cDNA libraries were constructed using poly(A) mRNA enrichment and the NEBNext Ultra™ II RNA Library Prep Kit for Illumina following manufacturer’s instructions (NEB, E7770S). RNA and library qualities were confirmed using Qubit Flourometric Quantification (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... RNA-seq libraries were prepared using the NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA, USA) according to manufacturer’s instructions and sequenced using HiSeq2500 (Illumina ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by cDNA generation (NEB 1st strand and NEB 2nd strand ultra directional Kits; New England BioLabs, Frankfurt am Main, Germany). Libraries were prepared using a NEBNext Ultra DNA kit (New England BioLabs ...
-
bioRxiv - Genomics 2020Quote: ... Novogene prepared a PCR free Illumina sequencing library using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs, USA), with the manufacturers protocol modified to give a 500 bp – 1 kb insert size ...
-
bioRxiv - Cancer Biology 2020Quote: ... and bar-coded libraries were constructed using the NEBNext Ultra™ Directional RNA Library Prep Kit for Illumina (NEB, Ipswich, MA). Libraries were pooled and single end-sequenced (1×75 ...
-
bioRxiv - Neuroscience 2020Quote: ... with PAM underlined: GCAACTGGTACAGATGACACAGG) targeting exon 21 of the Brp gene was generated using the HiScribe T7 Kit (New England Biolabs #E2040S) by incubating for 6 hours at 37°C ...
-
bioRxiv - Immunology 2020Quote: CAR-encoding mRNA was transcribed from linearized plasmids encoding anti-human CD19 CAR61 and anti-mouse CD19 CAR71 using T7 RNA polymerase (HiScribe™ T7 High Yield RNA Synthesis Kit, New England Biolabs). The mRNAs were transcribed to contain the 5′ UTR derived from the human a-globin 5′ leader RNA ...
-
bioRxiv - Microbiology 2021Quote: ... RNA passing quality control was converted to a sequencing ready library using the NEBNext Ultra II Directional RNA library kit with polyA selection as per the manufacturer’s instructions (NEB, Ipswich, MA). The cDNA libraries were quantitated using qPCR in a Roche LightCycler 480 with the Kapa Biosystems kit for Illumina library quantitation (Kapa Biosystems ...
-
bioRxiv - Microbiology 2021Quote: A549 cells were infected with PR8 at a MOI of 5 and lysates were collected every two hours post infection (hpi) until 8 h RNA extraction was performed with Monarch total RNA Miniprep kit (New England Biolabs GmbH) according to manufacturers’ instructions ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were purified with the oligonu-cleotide cleanup protocol as described in the Monarch PCR & DNA Cleanup Kit (5 μg) user manual (NEB #T1030). Purified PCR products were sequenced using Sanger methods by Eton Biosciences (https://www.etonbio.com/ ...
-
Histone H3K36me2-specific methyltransferase ASH1L is required for the MLL-AF9-induced leukemogenesisbioRxiv - Cancer Biology 2021Quote: ... was used to generate RNA-seq library using NEBNext Ultra Directional RNA library Prep Kit for Illumina (New England BioLabs, Inc) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... We isolated the total RNA from 2×107 cells using a Monarch Total RNA Miniprep Kit (T2010, New England Biolabs, MA) as described by the manufacturer with an additional 30-minute ...
-
bioRxiv - Microbiology 2021Quote: ... 10 ul of this was then used as an input for T7 polymerase mediated In vitro Transcription (IVT) using the NEB HiScribe T7 High Yield RNA Synthesis Kit (NEB, # E2040S). Briefly ...
-
bioRxiv - Developmental Biology 2022Quote: Reporter gene fusions for cis-regulatory analysis of terminal identity genes were made using either PCR fusion (Hobert, 2002) or Gibson Assembly Cloning Kit (NEB #5510S). Targeted DNA fragments were fused (ligated ...
-
bioRxiv - Genetics 2022Quote: ... Purified DNA was applied to Tru-Seq library construction using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, E7645S). For NEB kit ...
-
bioRxiv - Molecular Biology 2022Quote: pGEMHE plasmid constructs (Supplementary Table 2A) were linearized and 5’-capped mRNA was synthesized with T7 polymerase (NEB HiScribeT7 ARCA kit) according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... RNA-Seq libraries were prepared using the NEBNext Ultra Directional RNA Library Kit with 12 cycles of PCR and custom 8 bp indexes (New England Biolabs, UK). Libraries were multiplexed and sequenced on the Illumina HiSeq4000 as 75-nucleotide paired-end reads ...
-
bioRxiv - Systems Biology 2022Quote: Sequencing libraries were prepared with the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (NEB, Cat#E7765L) in 96-well plates ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Sequencing libraries were generated using NEBNext® Ultra™ RNA Library Prep Kit (E7530L) for Illumina® (NEB, Ipswich, MA, USA) following the manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Genomics 2022Quote: ... Biotinylated DNA was pulled down using streptavidin coated magnetic beads and prepared for multiplex sequencing on an Illumina platform using the NEBNext Ultra II kit (NEB, E7645S). All end preparation ...
-
bioRxiv - Cell Biology 2022Quote: TDP-43 with a C-terminal HA tag was directly amplified from the GFP-TDP-43 construct described above and inserted into an autoregulatory all-in-one TetON cassette previously inserted into pLVX backbone (81) by Gibson cloning using the NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs, E5520S) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... RNA-seq libraries were constructed using the Swift Rapid Library Prep Kit (Swift Bio #R2096) with NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB #E7490L) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... One-step quantitative RT-PCR was used to determine gene expression levels using the Luna Universal One-Step RT-qPCR kit (New England Biolabs Inc.) according to the manufacturer’s recommendations using 4 ng of total RNA per 20µl reaction ...
-
bioRxiv - Biochemistry 2022Quote: ... Primers carrying a G155A or G225V mutation were designed for site-directed mutagenesis using a Q5® Site-Directed Mutagenesis Kit (New England Biolabs).
-
bioRxiv - Molecular Biology 2022Quote: ... Unmethylated cytosines were then deaminated to uracil and indexed libraries were prepared using the NEBNext Enzymatic Methyl-seq Kit (NEB #E7120) before being pooled and then sequenced by Illumina paired-end (2×150bp ...
-
bioRxiv - Bioengineering 2022Quote: RNA fragments of AR-V7 and YAP1 sequences were synthesized from DNA gblocks (Integrated DNA Technologies) utilising the HiScribe™ T7 Quick High Yield RNA Synthesis Kit (NEB) according to the manufacturer’s instructions including the DNase step ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library quality was checked by an Agilent BioAnalyzer 2100 and libraries were quantified using the Library Quant Kit® (NEB, #E7630L) for Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... Bands from 200 to 400 bp were selected by extraction from a 2% agarose gel using a Monarch DNA Gel Extraction Kit (NEB#T1020L). Purified adaptor-DNA fragments were amplified by Phusion polymerase (NEB#M0530 ...
-
bioRxiv - Genetics 2019Quote: ... bps) was then column purified and transcribed using the T7 Quick High Yield RNA Synthesis kit (New England BioLabs, Ipswich, MA) and purified using RNA Clean and Concentrator kit (Zymo Research ...
-
bioRxiv - Cell Biology 2020Quote: ... ptubg-[DCX orthologue]-mNeonGreenFP was generated with a three-component assembly using the NEBuilder HiFi Assembly kit (New England Biolabs, E2621S) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... These normalised samples were pooled at an equimolar concentration and then quantified as per manufacturer’s instructions using the NEBNext Library Quant qPCR kit (New England Biolabs, Massachusetts, USA).