Labshake search
Citations for New England Biolabs :
9251 - 9300 of 10000+ citations for Mouse Tyrosinase Related Protein 1 TYRP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... PolyA + fraction was isolated from 4.5 μg of DNAse-treated total RNA using NEBNext Oligo d(T)25 Magnetic beads kit (NEB, USA), according to manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2022Quote: ... The Hi-C library for Illumina sequencing was prepared with the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB) according to the manufacturer’s instructions ...
-
Co-stimulatory molecules decide T cell fate through regulations of their invigoration and impairmentbioRxiv - Molecular Biology 2022Quote: ... mRNA sequencing libraries were prepared with 500 ng of total RNA of each sample using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB) with NEBNext Poly(A ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR amplicons were verified by agarose gel electrophoresis and purified using the Monarch PCR and DNA Cleanup Kit (New England Biolabs). In vitro transcription was performed using the T7 RiboMAX Express Large Scale RNA Production System (Promega) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and BRD4L-MU34 PAS reporters were generated by site-directed mutagenesis of TRIM9S-WT or BRD4L-WT PAS reporters using Q5 Site-Directed Mutagenesis Kit (New England Biolabs).
-
bioRxiv - Bioengineering 2022Quote: ... HiScribe T7 RNA polymerase kits and Q5 2x HiFidelity PCR mastermixes were purchased from New England Biolabs (NEB, Ipswitch, MA). Sodium cacodylate solution ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was used to generate barcoded RNA-seq libraries using the NEBNext Ultra II Directional RNA Library preparation kit (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... After 25 cycles of amplification the product was purified with the Monarch PCR&DNA Cleanup kit (New England BioLabs T1030L) and eluted with 20 μl of ddH2O ...
-
bioRxiv - Biochemistry 2022Quote: MBOAT7 mutants were generated by site-directed mutagenesis on the pFBM construct expressing MBOAT7 with a C-terminal GFP and strep tag using the Q5 Mutagenesis Kit (New England Biolabs), according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was used to generate barcoded RNA-seq libraries using the NEBNext Ultra RNA Library preparation kit (New England Biolabs). First ...
-
bioRxiv - Biochemistry 2022Quote: ... DED1 Trp-to-Ala point mutations were introduced using the Q5 site-directed mutagenesis kit (NEB, Frankfurt am Main, Germany) with primers carrying the sequence variation and verified by sequencing ...
-
bioRxiv - Biophysics 2022Quote: ... vulnificus adenine riboswitch aptamer domain by in vitro transcription of the corresponding DNA oligonucleotides (HiScribe T7 High Yield RNA Synthesis Kit, New England Biolabs; oligonucleotides ordered from Eurofins) ...
-
bioRxiv - Biophysics 2022Quote: ... a site-specific insertion of cysteine at position 287 was achieved in the long L4 loop of Mb4-tFhuA by site-directed mutagenesis (Q5 mutagenesis kit, New England Biolabs). This cysteine-containing Mb4-tFhuA was expressed and purified as described above ...
-
bioRxiv - Cancer Biology 2022Quote: ... NGS libraries were prepared from the purified mRNA using the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs). Ten cycles of PCR amplification were applied to all libraries ...
-
bioRxiv - Biochemistry 2022Quote: ... Fractions between 100–400 nt were cut and DNA was extracted from the gel by Monarch DNA Gel extraction Kit (NEB). Multiplexed samples were submitted to the IMG Genomics and Bioinformatics facility for library synthesis using the NextSeq® 500/550 High Output Kit v2 ...
-
bioRxiv - Biochemistry 2022Quote: Site-directed mutagenesis was performed in order to generate all the point mutants and variants described in this study using the Q5-site directed mutagenesis kit (New England Biolabs) following manufacturer instructions and the indicated primers (see extended material and methods).
-
bioRxiv - Biochemistry 2022Quote: ... a tolerant position was mutated to facilitate making a labeled LexA variant.56 The His-LexA W201C mutant was generated using a Q5 Site-Directed Mutagenesis Kit (NEB) and the mutation was confirmed via sequencing ...
-
bioRxiv - Bioengineering 2022Quote: ... Synthetic ORF1a target RNA fragment was produced from the corresponding cDNA fragment by in vitro transcription using the HiScribe T7 High Yield RNA Synthesis Kit (NEB), according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... The PCR products were purified and cleaned using a Monarch® PCR & DNA cleanup kit (New England BioLabs, Ipswich, MA). RNAs for the in vitro test were transcribed using a HiScribe™ T7 high yield RNA synthesis kit (New England BioLabs ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...
-
bioRxiv - Biochemistry 2022Quote: ... and luciferase DNA fragments were cloned into pUC18 at the same time by using NEBuilder HiFi DNA Assembly Cloning Kit (M5520, NEB) to form the substrate plasmid ...
-
bioRxiv - Biochemistry 2022Quote: ... and C-terminal truncations (-57Q, -56IQ, -55DIQ and -54DDIQ) were performed on phyg-C-CSNAP-cerulean using the Q5 mutagenesis kit (NEB). HAP1 WT cells were transfected with 5 μg plasmid DNA using JetPRIME (Polyplus) ...
-
bioRxiv - Cancer Biology 2022Quote: ... WES and RNA sequencing from the PDX samples was performed using NEBNext Ultra II FS DNA library Kit for Illumina (New England Biolabs), SureSelectXT HS Target Enrichment System for Illumina Paired-End Multiplexed Sequencing Library For Illumina Multiplexed Sequencing Platforms (Agilent) ...
-
bioRxiv - Cancer Biology 2022Quote: A range of 5 to 30 ng of cfDNA was used to generate WMS libraries with NEBNext Enzymatic Methyl-seq Kit (New England Biolabs) per manufacturer instructions.
-
bioRxiv - Developmental Biology 2022Quote: RNA-seq libraries were prepared using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, NEB) and NEBNext rRNA Depletion Kit (Human/Mouse/Rat ...
-
bioRxiv - Developmental Biology 2022Quote: RNA-seq libraries were prepared using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, NEB) and NEBNext rRNA Depletion Kit (Human/Mouse/Rat ...
-
bioRxiv - Cell Biology 2022Quote: ... 400 ng of high integrity total RNA (RIN >5) was depleted of rRNA using the NEBNext rRNA Depletion Kit (New England BioLabs). NEXTflex Rapid Directional RNA-Seq Kit (Bio-Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 μl of the oligo reaction was ligated with 50 ng of digested pX330 vector and was assessed using the Quick Ligase kit (New England Biolabs) for 20 min at room temperature according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: Paired end libraries were constructed using the NEBNext Ultra II RNA Library Prep Kit (New England Biolabs, Ipswich, MA, USA) following the manufacturer’s protocol and sequenced on a NovaSeq 6000 (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... another membrane-localized FRB (stargazin-iRFP670-FRB) was also generated by inserting FRB into Lego-iV2-stargazin-iRFP670 via the Q5 site-directed mutagenesis kit (NEB). The FRET-based VE-cad-TS (Addgene Plasmid# 45848 ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA fragments were amplified by PCR and transcribed to sgRNAs in vitro with HiScribe Quick T7 High Yield RNA Synthesis Kit (New England Biolabs), and sgRNAs were purified with Monarch RNA Cleanup Kit (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Library preparation was performed using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB #E7645S), following the manufacturer’s instructions.
-
bioRxiv - Genomics 2022Quote: ... Tip60 and Lam were generated by PCR amplifying the coding sequence of each chromatin factor from an embryonic cDNA library 54 with Gibson Assembly adaptor sequences and ligating using an NEB Hifi assembly kit (NEB). Cloning primers were designed using Perlprimer 55 ...
-
bioRxiv - Immunology 2022Quote: ... The constructs expressing mutant SLFNs (SLFN11 E209A, SLFN11 E214A, SLFN12 E200A and SLFN12 E205A) were generated using Q5 Site-Directed Mutagenesis Kit (NEB). The mutagenesis was performed according to the substitution protocol using primers designed with the NEBaseChanger (NEB) ...
-
bioRxiv - Genetics 2022Quote: The detection of aberrant Scyl1 transcripts was performed by RT-PCR using primers designed to amplify sequences between exon 2 to exon 5 (RT-Scyl1_F21 5’-CGCAGTGTCCATCTTCGTGTA-3’ and RT-Scyl1_R51 5’-CCCGGCAGTTCTGCAGGAA-3’) following the OneTaq One-Step RT-PCR Kit (New England Biolabs, E5315S) procedure ...
-
bioRxiv - Genetics 2022Quote: ... I23A was introduced at the same time with GFP knock-in by incorporating the corresponding mutation in the 3’ homology arm on the repair template plasmid using the Q5 site-directed mutagenesis kit (New England Biolabs). GermLine Optimized mScarlet-i sequence (Fielmich et al ...
-
bioRxiv - Genetics 2022Quote: ... samples with the best fragmentation and high concentration were used for the creation of NGS libraries (NEBNEXT ULTRA II DNA Library Prep kit, NEB) and sequencing (Illumina Next seq 500 ...
-
bioRxiv - Genetics 2022Quote: ... we also isolated genomic DNA from post-mortem liver tissue using the Monarch® Genomic DNA Purification Kit (NEB, T3010S).
-
bioRxiv - Immunology 2022Quote: RNA from sorted Kmt2d-knockout and littermate control thymic cells was isolated by centrifugation to pellet and resuspended in 300 μL of Protection Buffer (Monarch RNA Isolation Kit, #T2010S; New England Biolabs Inc. (NEB), Ipswich ...
-
bioRxiv - Immunology 2022Quote: ... followed by a NEBNext Ultra II Directional RNA library prep kit for Illumina (#E7760 and/or #E7770 with #E7765; NEB) with size selection by AMPure XP (#Ab3881 ...
-
bioRxiv - Immunology 2022Quote: Fab fragments were generated by inserting a stop codon six amino acids upstream of the hinge region (CPPCP) of the heavy chain expression plasmid using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs). This mutagenized plasmid was co-transfected with the respective light chain plasmid ...
-
bioRxiv - Immunology 2022Quote: ... A subset of SIV Envs was further modified by site-directed mutagenesis (Q5 Site-Directed Mutagenesis Kit; New England BioLabs) to incorporate amino acid changes previously reported to improve the germline-targeting capacity of HIV-1 Envs (20 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we extracted genomic DNA from a hind leg of each adult using Monarch Genomic DNA Purification Kit (New England Biolabs) and amplified the DNA using a UVRh1-specific primer pair (5’ CAAGCATTTGTCATTGATGCA 3’ ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... genomic DNA was extracted from the dissected thorax of single adult male and female butterflies from each species using Monarch Genomic DNA Purification Kit (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2022Quote: ... and cloned upstream of the TRP2 terminator and NatMX6 drug marker cassette in a pUC19-based vector using the NEB HiFi Assembly kit (New England Biolabs). This AB614_yOTC plasmid (GenBank ...
-
bioRxiv - Plant Biology 2022Quote: ... the plasmid was purified and used as template in a single reaction for dsRNA synthesis using the HiScribe T7 High Yield RNA synthesis kit (NEB). For plasmidic DNA removal ...
-
bioRxiv - Plant Biology 2022Quote: ... the acquired Mlathy INR and INR-like sequences were confirmed by PCR using the Q5 Hot Start High-Fidelity kit (NEB), enzymatic clean-up using ExoSAP-IT™ (Thermo Fisher scientific ...
-
bioRxiv - Microbiology 2022Quote: crRNAs were synthesized for in vitro cleavage experiments using the HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs; NEB). Templates for in vitro transcription were generated by hybridizing a ssDNA oligo with the T7 promoter to another oligo with the complementary T7 promoter sequence fused to the LbCas12a repeat and spacer in annealing buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... Libraries were barcoded, quantified using the NEBNext Ultra RNA Library Prep Kit for Illumina (Cat No. 7530, New England Biolabs (NEB)) ...
-
bioRxiv - Physiology 2022Quote: ... and Poly-A mRNA-seq libraries from such samples were prepared using the Ultra II Directional RNA Library kit (New England BioLabs) according to the manufacturer’s instructions ...